Dataset statistics
| Number of variables | 22 |
|---|---|
| Number of observations | 20000 |
| Missing cells | 0 |
| Missing cells (%) | 0.0% |
| Duplicate rows | 0 |
| Duplicate rows (%) | 0.0% |
| Total size in memory | 3.2 MiB |
| Average record size in memory | 169.0 B |
Variable types
| Numeric | 6 |
|---|---|
| Categorical | 15 |
| Boolean | 1 |
pubmed has constant value "26472758" | Constant |
cas has constant value "hSpCas9" | Constant |
screentype has constant value "negative selection" | Constant |
cellline has constant value "Jiyoye" | Constant |
condition has constant value "viability" | Constant |
scoredist has constant value "[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]" | Constant |
name has a high cardinality: 18459 distinct values | High cardinality |
chr has a high cardinality: 70 distinct values | High cardinality |
ensg has a high cardinality: 2083 distinct values | High cardinality |
symbol has a high cardinality: 1956 distinct values | High cardinality |
sequence has a high cardinality: 18349 distinct values | High cardinality |
genetargets has a high cardinality: 2083 distinct values | High cardinality |
rc_initial has a high cardinality: 643 distinct values | High cardinality |
rc_final has a high cardinality: 548 distinct values | High cardinality |
log2fc is highly correlated with effect | High correlation |
start is highly correlated with end | High correlation |
end is highly correlated with start | High correlation |
effect is highly correlated with log2fc | High correlation |
log2fc is highly correlated with effect | High correlation |
start is highly correlated with end | High correlation |
end is highly correlated with start | High correlation |
score is highly correlated with hit | High correlation |
hit is highly correlated with score | High correlation |
effect is highly correlated with log2fc | High correlation |
log2fc is highly correlated with effect | High correlation |
start is highly correlated with end | High correlation |
end is highly correlated with start | High correlation |
effect is highly correlated with log2fc | High correlation |
strand is highly correlated with pubmed and 5 other fields | High correlation |
pubmed is highly correlated with strand and 7 other fields | High correlation |
cas is highly correlated with strand and 7 other fields | High correlation |
condition is highly correlated with strand and 7 other fields | High correlation |
scoredist is highly correlated with strand and 7 other fields | High correlation |
cellline is highly correlated with strand and 7 other fields | High correlation |
screentype is highly correlated with strand and 7 other fields | High correlation |
hit is highly correlated with pubmed and 5 other fields | High correlation |
chr is highly correlated with pubmed and 5 other fields | High correlation |
Unnamed: 0 is highly correlated with chr | High correlation |
log2fc is highly correlated with effect | High correlation |
chr is highly correlated with Unnamed: 0 and 3 other fields | High correlation |
start is highly correlated with chr and 1 other fields | High correlation |
end is highly correlated with chr and 1 other fields | High correlation |
score is highly correlated with chr and 1 other fields | High correlation |
hit is highly correlated with score | High correlation |
effect is highly correlated with log2fc | High correlation |
Unnamed: 0 is uniformly distributed | Uniform |
name is uniformly distributed | Uniform |
ensg is uniformly distributed | Uniform |
sequence is uniformly distributed | Uniform |
genetargets is uniformly distributed | Uniform |
Unnamed: 0 has unique values | Unique |
effect has 2043 (10.2%) zeros | Zeros |
Reproduction
| Analysis started | 2022-06-10 03:11:10.219661 |
|---|---|
| Analysis finished | 2022-06-10 03:11:18.322254 |
| Duration | 8.1 seconds |
| Software version | pandas-profiling v3.2.0 |
| Download configuration | config.json |
| Distinct | 20000 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 9999.5 |
| Minimum | 0 |
|---|---|
| Maximum | 19999 |
| Zeros | 1 |
| Zeros (%) | < 0.1% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 156.4 KiB |
Quantile statistics
| Minimum | 0 |
|---|---|
| 5-th percentile | 999.95 |
| Q1 | 4999.75 |
| median | 9999.5 |
| Q3 | 14999.25 |
| 95-th percentile | 18999.05 |
| Maximum | 19999 |
| Range | 19999 |
| Interquartile range (IQR) | 9999.5 |
Descriptive statistics
| Standard deviation | 5773.647028 |
|---|---|
| Coefficient of variation (CV) | 0.5773935724 |
| Kurtosis | -1.2 |
| Mean | 9999.5 |
| Median Absolute Deviation (MAD) | 5000 |
| Skewness | 0 |
| Sum | 199990000 |
| Variance | 33335000 |
| Monotonicity | Strictly increasing |
| Value | Count | Frequency (%) |
| 0 | 1 | < 0.1% |
| 13330 | 1 | < 0.1% |
| 13337 | 1 | < 0.1% |
| 13336 | 1 | < 0.1% |
| 13335 | 1 | < 0.1% |
| 13334 | 1 | < 0.1% |
| 13333 | 1 | < 0.1% |
| 13332 | 1 | < 0.1% |
| 13331 | 1 | < 0.1% |
| 13329 | 1 | < 0.1% |
| Other values (19990) | 19990 |
| Value | Count | Frequency (%) |
| 0 | 1 | |
| 1 | 1 | |
| 2 | 1 | |
| 3 | 1 | |
| 4 | 1 | |
| 5 | 1 | |
| 6 | 1 | |
| 7 | 1 | |
| 8 | 1 | |
| 9 | 1 |
| Value | Count | Frequency (%) |
| 19999 | 1 | |
| 19998 | 1 | |
| 19997 | 1 | |
| 19996 | 1 | |
| 19995 | 1 | |
| 19994 | 1 | |
| 19993 | 1 | |
| 19992 | 1 | |
| 19991 | 1 | |
| 19990 | 1 |
| Distinct | 18459 |
|---|---|
| Distinct (%) | 92.3% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| sgATP6V1G2_1 | 7 |
|---|---|
| sgABCF1_3 | 7 |
| sgABCF1_10 | 7 |
| sgABCF1_1 | 7 |
| sgAGPAT1_5 | 7 |
| Other values (18454) |
Length
| Max length | 20 |
|---|---|
| Median length | 18 |
| Mean length | 9.86395 |
| Min length | 6 |
Characters and Unicode
| Total characters | 197279 |
|---|---|
| Distinct characters | 43 |
| Distinct categories | 5 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 17663 ? |
|---|---|
| Unique (%) | 88.3% |
Sample
| 1st row | sgA1CF_1 |
|---|---|
| 2nd row | sgA1CF_10 |
| 3rd row | sgA1CF_2 |
| 4th row | sgA1CF_3 |
| 5th row | sgA1CF_4 |
Common Values
| Value | Count | Frequency (%) |
| sgATP6V1G2_1 | 7 | < 0.1% |
| sgABCF1_3 | 7 | < 0.1% |
| sgABCF1_10 | 7 | < 0.1% |
| sgABCF1_1 | 7 | < 0.1% |
| sgAGPAT1_5 | 7 | < 0.1% |
| sgAGPAT1_6 | 7 | < 0.1% |
| sgAGPAT1_7 | 7 | < 0.1% |
| sgAGPAT1_8 | 7 | < 0.1% |
| sgATAT1_5 | 7 | < 0.1% |
| sgATAT1_4 | 7 | < 0.1% |
| Other values (18449) | 19930 |
Length
| Value | Count | Frequency (%) |
| sgatp6v1g2_1 | 7 | < 0.1% |
| sgapom_9 | 7 | < 0.1% |
| sgapom_10 | 7 | < 0.1% |
| sgapom_2 | 7 | < 0.1% |
| sgabcf1_7 | 7 | < 0.1% |
| sgabcf1_8 | 7 | < 0.1% |
| sgabcf1_9 | 7 | < 0.1% |
| sgagpat1_4 | 7 | < 0.1% |
| sgagpat1_3 | 7 | < 0.1% |
| sgagpat1_2 | 7 | < 0.1% |
| Other values (18449) | 19930 |
Most occurring characters
| Value | Count | Frequency (%) |
| s | 20000 | 10.1% |
| g | 20000 | 10.1% |
| _ | 20000 | 10.1% |
| A | 18827 | 9.5% |
| 1 | 14821 | 7.5% |
| 2 | 7580 | 3.8% |
| C | 7494 | 3.8% |
| B | 6879 | 3.5% |
| P | 5027 | 2.5% |
| 3 | 5006 | 2.5% |
| Other values (33) | 71645 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 75697 | |
| Decimal Number | 53068 | |
| Lowercase Letter | 48463 | |
| Connector Punctuation | 20000 | 10.1% |
| Dash Punctuation | 51 | < 0.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 18827 | |
| C | 7494 | 9.9% |
| B | 6879 | 9.1% |
| P | 5027 | 6.6% |
| R | 4653 | 6.1% |
| T | 4191 | 5.5% |
| D | 3918 | 5.2% |
| L | 3466 | 4.6% |
| G | 2712 | 3.6% |
| N | 2587 | 3.4% |
| Other values (16) | 15943 |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 14821 | |
| 2 | 7580 | |
| 3 | 5006 | 9.4% |
| 4 | 4290 | 8.1% |
| 5 | 3972 | 7.5% |
| 6 | 3920 | 7.4% |
| 7 | 3617 | 6.8% |
| 0 | 3443 | 6.5% |
| 9 | 3268 | 6.2% |
| 8 | 3151 | 5.9% |
Lowercase Letter
| Value | Count | Frequency (%) |
| s | 20000 | |
| g | 20000 | |
| f | 2821 | 5.8% |
| r | 2821 | 5.8% |
| o | 2821 | 5.8% |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 20000 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 51 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 124160 | |
| Common | 73119 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| s | 20000 | |
| g | 20000 | |
| A | 18827 | |
| C | 7494 | 6.0% |
| B | 6879 | 5.5% |
| P | 5027 | 4.0% |
| R | 4653 | 3.7% |
| T | 4191 | 3.4% |
| D | 3918 | 3.2% |
| L | 3466 | 2.8% |
| Other values (21) | 29705 |
Common
| Value | Count | Frequency (%) |
| _ | 20000 | |
| 1 | 14821 | |
| 2 | 7580 | 10.4% |
| 3 | 5006 | 6.8% |
| 4 | 4290 | 5.9% |
| 5 | 3972 | 5.4% |
| 6 | 3920 | 5.4% |
| 7 | 3617 | 4.9% |
| 0 | 3443 | 4.7% |
| 9 | 3268 | 4.5% |
| Other values (2) | 3202 | 4.4% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 197279 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| s | 20000 | 10.1% |
| g | 20000 | 10.1% |
| _ | 20000 | 10.1% |
| A | 18827 | 9.5% |
| 1 | 14821 | 7.5% |
| 2 | 7580 | 3.8% |
| C | 7494 | 3.8% |
| B | 6879 | 3.5% |
| P | 5027 | 2.5% |
| 3 | 5006 | 2.5% |
| Other values (33) | 71645 |
| Distinct | 12525 |
|---|---|
| Distinct (%) | 62.6% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 0.1441097578 |
| Minimum | -7.452876964 |
|---|---|
| Maximum | 7.277540101 |
| Zeros | 1 |
| Zeros (%) | < 0.1% |
| Negative | 8863 |
| Negative (%) | 44.3% |
| Memory size | 156.4 KiB |
Quantile statistics
| Minimum | -7.452876964 |
|---|---|
| 5-th percentile | -1.93677902 |
| Q1 | -0.4997152141 |
| median | 0.1273343809 |
| Q3 | 0.7226772072 |
| 95-th percentile | 2.261357163 |
| Maximum | 7.277540101 |
| Range | 14.73041706 |
| Interquartile range (IQR) | 1.222392421 |
Descriptive statistics
| Standard deviation | 1.431208752 |
|---|---|
| Coefficient of variation (CV) | 9.931379903 |
| Kurtosis | 4.752142078 |
| Mean | 0.1441097578 |
| Median Absolute Deviation (MAD) | 0.6109299297 |
| Skewness | 0.3620742912 |
| Sum | 2882.195155 |
| Variance | 2.048358492 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 0.4071753815 | 114 | 0.6% |
| 0.4071753815 | 63 | 0.3% |
| 2.729103476 | 35 | 0.2% |
| 0.9921378822 | 33 | 0.2% |
| 1.992137882 | 32 | 0.2% |
| 0.4071753815 | 32 | 0.2% |
| 3.866607 | 30 | 0.1% |
| 2.407175382 | 29 | 0.1% |
| -1.177787119 | 28 | 0.1% |
| 3.729103476 | 26 | 0.1% |
| Other values (12515) | 19578 |
| Value | Count | Frequency (%) |
| -7.452876964 | 1 | < 0.1% |
| -7.387240485 | 1 | < 0.1% |
| -7.300183751 | 1 | < 0.1% |
| -7.258160536 | 1 | < 0.1% |
| -6.963512025 | 1 | < 0.1% |
| -6.882843465 | 1 | < 0.1% |
| -6.850212461 | 1 | < 0.1% |
| -6.811993139 | 1 | < 0.1% |
| -6.792496963 | 1 | < 0.1% |
| -6.615192432 | 3 |
| Value | Count | Frequency (%) |
| 7.277540101 | 1 | < 0.1% |
| 7.240065396 | 1 | < 0.1% |
| 7.175359706 | 2 | |
| 7.162062884 | 1 | < 0.1% |
| 7.036532002 | 2 | |
| 7.021885226 | 1 | < 0.1% |
| 6.97703099 | 2 | |
| 6.914970022 | 1 | < 0.1% |
| 6.899028478 | 3 | |
| 6.882908812 | 1 | < 0.1% |
| Distinct | 70 |
|---|---|
| Distinct (%) | 0.4% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| 1 | |
|---|---|
| 2 | |
| 11 | |
| 17 | 1179 |
| 12 | 1151 |
| Other values (65) |
Length
| Max length | 24 |
|---|---|
| Median length | 23 |
| Mean length | 2.7003 |
| Min length | 1 |
Characters and Unicode
| Total characters | 54006 |
|---|---|
| Distinct characters | 29 |
| Distinct categories | 3 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2 ? |
|---|---|
| Unique (%) | < 0.1% |
Sample
| 1st row | 10 |
|---|---|
| 2nd row | 10 |
| 3rd row | 10 |
| 4th row | 10 |
| 5th row | 10 |
Common Values
| Value | Count | Frequency (%) |
| 1 | 2168 | 10.8% |
| 2 | 1300 | 6.5% |
| 11 | 1299 | 6.5% |
| 17 | 1179 | 5.9% |
| 12 | 1151 | 5.8% |
| 10 | 1132 | 5.7% |
| 19 | 1063 | 5.3% |
| 3 | 898 | 4.5% |
| 7 | 840 | 4.2% |
| 16 | 790 | 4.0% |
| Other values (60) | 8180 |
Length
| Value | Count | Frequency (%) |
| 1 | 2168 | 10.8% |
| 2 | 1300 | 6.5% |
| 11 | 1299 | 6.5% |
| 17 | 1179 | 5.9% |
| 12 | 1151 | 5.8% |
| 10 | 1132 | 5.7% |
| 19 | 1063 | 5.3% |
| 3 | 898 | 4.5% |
| 7 | 840 | 4.2% |
| 16 | 790 | 4.0% |
| Other values (60) | 8180 |
Most occurring characters
| Value | Count | Frequency (%) |
| 1 | 13569 | |
| C | 4568 | 8.5% |
| 2 | 4484 | 8.3% |
| _ | 4392 | 8.1% |
| H | 4345 | 8.0% |
| R | 2404 | 4.5% |
| 7 | 2276 | 4.2% |
| 6 | 2172 | 4.0% |
| 9 | 1783 | 3.3% |
| 0 | 1753 | 3.2% |
| Other values (19) | 12260 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 31021 | |
| Uppercase Letter | 18593 | |
| Connector Punctuation | 4392 | 8.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| C | 4568 | |
| H | 4345 | |
| R | 2404 | |
| S | 1401 | 7.5% |
| T | 1324 | 7.1% |
| G | 1217 | 6.5% |
| M | 918 | 4.9% |
| X | 892 | 4.8% |
| B | 319 | 1.7% |
| O | 234 | 1.3% |
| Other values (8) | 971 | 5.2% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 13569 | |
| 2 | 4484 | 14.5% |
| 7 | 2276 | 7.3% |
| 6 | 2172 | 7.0% |
| 9 | 1783 | 5.7% |
| 0 | 1753 | 5.7% |
| 4 | 1524 | 4.9% |
| 5 | 1452 | 4.7% |
| 3 | 1250 | 4.0% |
| 8 | 758 | 2.4% |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 4392 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 35413 | |
| Latin | 18593 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| C | 4568 | |
| H | 4345 | |
| R | 2404 | |
| S | 1401 | 7.5% |
| T | 1324 | 7.1% |
| G | 1217 | 6.5% |
| M | 918 | 4.9% |
| X | 892 | 4.8% |
| B | 319 | 1.7% |
| O | 234 | 1.3% |
| Other values (8) | 971 | 5.2% |
Common
| Value | Count | Frequency (%) |
| 1 | 13569 | |
| 2 | 4484 | 12.7% |
| _ | 4392 | 12.4% |
| 7 | 2276 | 6.4% |
| 6 | 2172 | 6.1% |
| 9 | 1783 | 5.0% |
| 0 | 1753 | 5.0% |
| 4 | 1524 | 4.3% |
| 5 | 1452 | 4.1% |
| 3 | 1250 | 3.5% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 54006 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 1 | 13569 | |
| C | 4568 | 8.5% |
| 2 | 4484 | 8.3% |
| _ | 4392 | 8.1% |
| H | 4345 | 8.0% |
| R | 2404 | 4.5% |
| 7 | 2276 | 4.2% |
| 6 | 2172 | 4.0% |
| 9 | 1783 | 3.3% |
| 0 | 1753 | 3.2% |
| Other values (19) | 12260 |
| Distinct | 19498 |
|---|---|
| Distinct (%) | 97.5% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 72761333.22 |
| Minimum | 205615 |
|---|---|
| Maximum | 247112172 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 156.4 KiB |
Quantile statistics
| Minimum | 205615 |
|---|---|
| 5-th percentile | 4115365.4 |
| Q1 | 31622858.25 |
| median | 57631653 |
| Q3 | 105548725.5 |
| 95-th percentile | 185397235.7 |
| Maximum | 247112172 |
| Range | 246906557 |
| Interquartile range (IQR) | 73925867.25 |
Descriptive statistics
| Standard deviation | 55829408.96 |
|---|---|
| Coefficient of variation (CV) | 0.7672950246 |
| Kurtosis | 0.3853041092 |
| Mean | 72761333.22 |
| Median Absolute Deviation (MAD) | 35423902.5 |
| Skewness | 0.951766337 |
| Sum | 1.455226664 × 1012 |
| Variance | 3.116922905 × 1015 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 66127695 | 4 | < 0.1% |
| 64373607 | 4 | < 0.1% |
| 64373217 | 4 | < 0.1% |
| 40226937 | 4 | < 0.1% |
| 66149287 | 4 | < 0.1% |
| 67884549 | 4 | < 0.1% |
| 40248527 | 4 | < 0.1% |
| 64394801 | 4 | < 0.1% |
| 66148897 | 4 | < 0.1% |
| 40227327 | 4 | < 0.1% |
| Other values (19488) | 19960 |
| Value | Count | Frequency (%) |
| 205615 | 1 | |
| 205626 | 1 | |
| 205637 | 1 | |
| 205658 | 1 | |
| 205960 | 1 | |
| 205978 | 1 | |
| 205990 | 1 | |
| 206014 | 1 | |
| 206031 | 1 | |
| 207310 | 1 |
| Value | Count | Frequency (%) |
| 247112172 | 1 | |
| 247112135 | 1 | |
| 247112092 | 1 | |
| 247111998 | 1 | |
| 247111975 | 1 | |
| 247111836 | 1 | |
| 247111713 | 1 | |
| 247111681 | 1 | |
| 247111620 | 1 | |
| 247111523 | 1 |
| Distinct | 19498 |
|---|---|
| Distinct (%) | 97.5% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 72761356.22 |
| Minimum | 205638 |
|---|---|
| Maximum | 247112195 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 156.4 KiB |
Quantile statistics
| Minimum | 205638 |
|---|---|
| 5-th percentile | 4115388.4 |
| Q1 | 31622881.25 |
| median | 57631676 |
| Q3 | 105548748.5 |
| 95-th percentile | 185397258.7 |
| Maximum | 247112195 |
| Range | 246906557 |
| Interquartile range (IQR) | 73925867.25 |
Descriptive statistics
| Standard deviation | 55829408.96 |
|---|---|
| Coefficient of variation (CV) | 0.767294782 |
| Kurtosis | 0.3853041092 |
| Mean | 72761356.22 |
| Median Absolute Deviation (MAD) | 35423902.5 |
| Skewness | 0.951766337 |
| Sum | 1.455227124 × 1012 |
| Variance | 3.116922905 × 1015 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 66127718 | 4 | < 0.1% |
| 64373630 | 4 | < 0.1% |
| 64373240 | 4 | < 0.1% |
| 40226960 | 4 | < 0.1% |
| 66149310 | 4 | < 0.1% |
| 67884572 | 4 | < 0.1% |
| 40248550 | 4 | < 0.1% |
| 64394824 | 4 | < 0.1% |
| 66148920 | 4 | < 0.1% |
| 40227350 | 4 | < 0.1% |
| Other values (19488) | 19960 |
| Value | Count | Frequency (%) |
| 205638 | 1 | |
| 205649 | 1 | |
| 205660 | 1 | |
| 205681 | 1 | |
| 205983 | 1 | |
| 206001 | 1 | |
| 206013 | 1 | |
| 206037 | 1 | |
| 206054 | 1 | |
| 207333 | 1 |
| Value | Count | Frequency (%) |
| 247112195 | 1 | |
| 247112158 | 1 | |
| 247112115 | 1 | |
| 247112021 | 1 | |
| 247111998 | 1 | |
| 247111859 | 1 | |
| 247111736 | 1 | |
| 247111704 | 1 | |
| 247111643 | 1 | |
| 247111546 | 1 |
| Distinct | 2083 |
|---|---|
| Distinct (%) | 10.4% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| ENSG00000172014 | 36 |
|---|---|
| ENSG00000276203 | 34 |
| ENSG00000185894 | 30 |
| ENSG00000174876 | 30 |
| ENSG00000237763 | 30 |
| Other values (2078) |
Length
| Max length | 15 |
|---|---|
| Median length | 15 |
| Mean length | 15 |
| Min length | 15 |
Characters and Unicode
| Total characters | 300000 |
|---|---|
| Distinct characters | 14 |
| Distinct categories | 2 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 38 ? |
|---|---|
| Unique (%) | 0.2% |
Sample
| 1st row | ENSG00000148584 |
|---|---|
| 2nd row | ENSG00000148584 |
| 3rd row | ENSG00000148584 |
| 4th row | ENSG00000148584 |
| 5th row | ENSG00000148584 |
Common Values
| Value | Count | Frequency (%) |
| ENSG00000172014 | 36 | 0.2% |
| ENSG00000276203 | 34 | 0.2% |
| ENSG00000185894 | 30 | 0.1% |
| ENSG00000174876 | 30 | 0.1% |
| ENSG00000237763 | 30 | 0.1% |
| ENSG00000187733 | 30 | 0.1% |
| ENSG00000183795 | 30 | 0.1% |
| ENSG00000183753 | 30 | 0.1% |
| ENSG00000183148 | 29 | 0.1% |
| ENSG00000187134 | 25 | 0.1% |
| Other values (2073) | 19696 |
Length
| Value | Count | Frequency (%) |
| ensg00000172014 | 36 | 0.2% |
| ensg00000276203 | 34 | 0.2% |
| ensg00000185894 | 30 | 0.1% |
| ensg00000237763 | 30 | 0.1% |
| ensg00000187733 | 30 | 0.1% |
| ensg00000183795 | 30 | 0.1% |
| ensg00000183753 | 30 | 0.1% |
| ensg00000174876 | 30 | 0.1% |
| ensg00000183148 | 29 | 0.1% |
| ensg00000187134 | 25 | 0.1% |
| Other values (2073) | 19696 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 112027 | |
| 1 | 24286 | 8.1% |
| E | 20000 | 6.7% |
| N | 20000 | 6.7% |
| S | 20000 | 6.7% |
| G | 20000 | 6.7% |
| 2 | 12286 | 4.1% |
| 6 | 11286 | 3.8% |
| 7 | 11211 | 3.7% |
| 3 | 10807 | 3.6% |
| Other values (4) | 38097 | 12.7% |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 220000 | |
| Uppercase Letter | 80000 | 26.7% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 112027 | |
| 1 | 24286 | 11.0% |
| 2 | 12286 | 5.6% |
| 6 | 11286 | 5.1% |
| 7 | 11211 | 5.1% |
| 3 | 10807 | 4.9% |
| 8 | 10196 | 4.6% |
| 4 | 10049 | 4.6% |
| 5 | 9399 | 4.3% |
| 9 | 8453 | 3.8% |
Uppercase Letter
| Value | Count | Frequency (%) |
| E | 20000 | |
| N | 20000 | |
| S | 20000 | |
| G | 20000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 220000 | |
| Latin | 80000 | 26.7% |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 0 | 112027 | |
| 1 | 24286 | 11.0% |
| 2 | 12286 | 5.6% |
| 6 | 11286 | 5.1% |
| 7 | 11211 | 5.1% |
| 3 | 10807 | 4.9% |
| 8 | 10196 | 4.6% |
| 4 | 10049 | 4.6% |
| 5 | 9399 | 4.3% |
| 9 | 8453 | 3.8% |
Latin
| Value | Count | Frequency (%) |
| E | 20000 | |
| N | 20000 | |
| S | 20000 | |
| G | 20000 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 300000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 112027 | |
| 1 | 24286 | 8.1% |
| E | 20000 | 6.7% |
| N | 20000 | 6.7% |
| S | 20000 | 6.7% |
| G | 20000 | 6.7% |
| 2 | 12286 | 4.1% |
| 6 | 11286 | 3.8% |
| 7 | 11211 | 3.7% |
| 3 | 10807 | 3.6% |
| Other values (4) | 38097 | 12.7% |
| Distinct | 1956 |
|---|---|
| Distinct (%) | 9.8% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| APOM | 70 |
|---|---|
| ATP6V1G2 | 70 |
| BAG6 | 70 |
| ATAT1 | 70 |
| ABCF1 | 70 |
| Other values (1951) |
Length
| Max length | 15 |
|---|---|
| Median length | 13 |
| Mean length | 5.76775 |
| Min length | 2 |
Characters and Unicode
| Total characters | 115355 |
|---|---|
| Distinct characters | 40 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 34 ? |
|---|---|
| Unique (%) | 0.2% |
Sample
| 1st row | A1CF |
|---|---|
| 2nd row | A1CF |
| 3rd row | A1CF |
| 4th row | A1CF |
| 5th row | A1CF |
Common Values
| Value | Count | Frequency (%) |
| APOM | 70 | 0.4% |
| ATP6V1G2 | 70 | 0.4% |
| BAG6 | 70 | 0.4% |
| ATAT1 | 70 | 0.4% |
| ABCF1 | 70 | 0.4% |
| AGER | 68 | 0.3% |
| AGPAT1 | 63 | 0.3% |
| BRD2 | 63 | 0.3% |
| AIF1 | 60 | 0.3% |
| ARL17B | 57 | 0.3% |
| Other values (1946) | 19339 |
Length
| Value | Count | Frequency (%) |
| apom | 70 | 0.4% |
| atat1 | 70 | 0.4% |
| abcf1 | 70 | 0.4% |
| atp6v1g2 | 70 | 0.4% |
| bag6 | 70 | 0.4% |
| ager | 68 | 0.3% |
| agpat1 | 63 | 0.3% |
| brd2 | 63 | 0.3% |
| aif1 | 60 | 0.3% |
| arl17b | 57 | 0.3% |
| Other values (1946) | 19339 |
Most occurring characters
| Value | Count | Frequency (%) |
| A | 18588 | |
| 1 | 10743 | 9.3% |
| C | 7459 | 6.5% |
| B | 6795 | 5.9% |
| 2 | 5593 | 4.8% |
| P | 5158 | 4.5% |
| R | 4662 | 4.0% |
| T | 4253 | 3.7% |
| D | 3932 | 3.4% |
| L | 3524 | 3.1% |
| Other values (30) | 44648 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 75977 | |
| Decimal Number | 31032 | |
| Lowercase Letter | 8247 | 7.1% |
| Dash Punctuation | 99 | 0.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 18588 | |
| C | 7459 | |
| B | 6795 | 8.9% |
| P | 5158 | 6.8% |
| R | 4662 | 6.1% |
| T | 4253 | 5.6% |
| D | 3932 | 5.2% |
| L | 3524 | 4.6% |
| G | 2765 | 3.6% |
| N | 2611 | 3.4% |
| Other values (16) | 16230 |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 10743 | |
| 2 | 5593 | |
| 3 | 3084 | 9.9% |
| 4 | 2259 | 7.3% |
| 5 | 1976 | 6.4% |
| 6 | 1873 | 6.0% |
| 7 | 1654 | 5.3% |
| 0 | 1412 | 4.6% |
| 9 | 1331 | 4.3% |
| 8 | 1107 | 3.6% |
Lowercase Letter
| Value | Count | Frequency (%) |
| o | 2749 | |
| f | 2749 | |
| r | 2749 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 99 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 84224 | |
| Common | 31131 | 27.0% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| A | 18588 | |
| C | 7459 | 8.9% |
| B | 6795 | 8.1% |
| P | 5158 | 6.1% |
| R | 4662 | 5.5% |
| T | 4253 | 5.0% |
| D | 3932 | 4.7% |
| L | 3524 | 4.2% |
| G | 2765 | 3.3% |
| o | 2749 | 3.3% |
| Other values (19) | 24339 |
Common
| Value | Count | Frequency (%) |
| 1 | 10743 | |
| 2 | 5593 | |
| 3 | 3084 | 9.9% |
| 4 | 2259 | 7.3% |
| 5 | 1976 | 6.3% |
| 6 | 1873 | 6.0% |
| 7 | 1654 | 5.3% |
| 0 | 1412 | 4.5% |
| 9 | 1331 | 4.3% |
| 8 | 1107 | 3.6% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 115355 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| A | 18588 | |
| 1 | 10743 | 9.3% |
| C | 7459 | 6.5% |
| B | 6795 | 5.9% |
| 2 | 5593 | 4.8% |
| P | 5158 | 4.5% |
| R | 4662 | 4.0% |
| T | 4253 | 3.7% |
| D | 3932 | 3.4% |
| L | 3524 | 3.1% |
| Other values (30) | 44648 |
| Distinct | 18349 |
|---|---|
| Distinct (%) | 91.7% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| GGAGAGTGACCACTTGCACATGG | 16 |
|---|---|
| ATAGTCAATGGACAAGGAGAAGG | 16 |
| GTGCTTCAATATGTGCACCATGG | 16 |
| TCATGCGAAGATCCAGGTAAAGG | 16 |
| TGAGGTGCTCTCACTATACACGG | 16 |
| Other values (18344) |
Length
| Max length | 23 |
|---|---|
| Median length | 23 |
| Mean length | 23 |
| Min length | 23 |
Characters and Unicode
| Total characters | 460000 |
|---|---|
| Distinct characters | 4 |
| Distinct categories | 1 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 17645 ? |
|---|---|
| Unique (%) | 88.2% |
Sample
| 1st row | GCAGCATCCCAACCAGGTGGAGG |
|---|---|
| 2nd row | GCGGGAGTGAGAGGACTGGGCGG |
| 3rd row | ATGACTCTCATACTCCACGAAGG |
| 4th row | GAGTCATCGAGCAGCTGCCATGG |
| 5th row | AGTCACCCTAGCAAAACCAGTGG |
Common Values
| Value | Count | Frequency (%) |
| GGAGAGTGACCACTTGCACATGG | 16 | 0.1% |
| ATAGTCAATGGACAAGGAGAAGG | 16 | 0.1% |
| GTGCTTCAATATGTGCACCATGG | 16 | 0.1% |
| TCATGCGAAGATCCAGGTAAAGG | 16 | 0.1% |
| TGAGGTGCTCTCACTATACACGG | 16 | 0.1% |
| GAGCGATATTTAGCTCCCAAGGG | 12 | 0.1% |
| AGCCAGGACACGTGCAGGACAGG | 9 | < 0.1% |
| TTCTAGGTAATTGATCTGGGTGG | 9 | < 0.1% |
| TGTGGTAATGCTGTGAGTGCAGG | 9 | < 0.1% |
| GTTGGGCCACCAAATGATAATGG | 9 | < 0.1% |
| Other values (18339) | 19872 |
Length
| Value | Count | Frequency (%) |
| ggagagtgaccacttgcacatgg | 16 | 0.1% |
| gtgcttcaatatgtgcaccatgg | 16 | 0.1% |
| tcatgcgaagatccaggtaaagg | 16 | 0.1% |
| tgaggtgctctcactatacacgg | 16 | 0.1% |
| atagtcaatggacaaggagaagg | 16 | 0.1% |
| gagcgatatttagctcccaaggg | 12 | 0.1% |
| tacctgtgaaaatctggggcagg | 9 | < 0.1% |
| gactagatgcaacaatgttgggg | 9 | < 0.1% |
| catacctttggactgaagcaagg | 9 | < 0.1% |
| tggtcttctcgatcttgcactgg | 9 | < 0.1% |
| Other values (18339) | 19872 |
Most occurring characters
| Value | Count | Frequency (%) |
| G | 172114 | |
| A | 112466 | |
| C | 102550 | |
| T | 72870 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 460000 |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| G | 172114 | |
| A | 112466 | |
| C | 102550 | |
| T | 72870 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 460000 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| G | 172114 | |
| A | 112466 | |
| C | 102550 | |
| T | 72870 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 460000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| G | 172114 | |
| A | 112466 | |
| C | 102550 | |
| T | 72870 |
| Distinct | 2 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| + | |
|---|---|
| - |
Length
| Max length | 1 |
|---|---|
| Median length | 1 |
| Mean length | 1 |
| Min length | 1 |
Characters and Unicode
| Total characters | 20000 |
|---|---|
| Distinct characters | 2 |
| Distinct categories | 2 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | + |
|---|---|
| 2nd row | - |
| 3rd row | + |
| 4th row | - |
| 5th row | - |
Common Values
| Value | Count | Frequency (%) |
| + | 10079 | |
| - | 9921 |
Length
Category Frequency Plot
| Value | Count | Frequency (%) |
| 20000 |
Most occurring characters
| Value | Count | Frequency (%) |
| + | 10079 | |
| - | 9921 |
Most occurring categories
| Value | Count | Frequency (%) |
| Math Symbol | 10079 | |
| Dash Punctuation | 9921 |
Most frequent character per category
Math Symbol
| Value | Count | Frequency (%) |
| + | 10079 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 9921 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 20000 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| + | 10079 | |
| - | 9921 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 20000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| + | 10079 | |
| - | 9921 |
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| 26472758 |
|---|
Length
| Max length | 8 |
|---|---|
| Median length | 8 |
| Mean length | 8 |
| Min length | 8 |
Characters and Unicode
| Total characters | 160000 |
|---|---|
| Distinct characters | 6 |
| Distinct categories | 1 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | 26472758 |
|---|---|
| 2nd row | 26472758 |
| 3rd row | 26472758 |
| 4th row | 26472758 |
| 5th row | 26472758 |
Common Values
| Value | Count | Frequency (%) |
| 26472758 | 20000 |
Length
Category Frequency Plot
| Value | Count | Frequency (%) |
| 26472758 | 20000 |
Most occurring characters
| Value | Count | Frequency (%) |
| 2 | 40000 | |
| 7 | 40000 | |
| 6 | 20000 | |
| 4 | 20000 | |
| 5 | 20000 | |
| 8 | 20000 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 160000 |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 2 | 40000 | |
| 7 | 40000 | |
| 6 | 20000 | |
| 4 | 20000 | |
| 5 | 20000 | |
| 8 | 20000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 160000 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 2 | 40000 | |
| 7 | 40000 | |
| 6 | 20000 | |
| 4 | 20000 | |
| 5 | 20000 | |
| 8 | 20000 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 160000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 2 | 40000 | |
| 7 | 40000 | |
| 6 | 20000 | |
| 4 | 20000 | |
| 5 | 20000 | |
| 8 | 20000 |
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| hSpCas9 |
|---|
Length
| Max length | 7 |
|---|---|
| Median length | 7 |
| Mean length | 7 |
| Min length | 7 |
Characters and Unicode
| Total characters | 140000 |
|---|---|
| Distinct characters | 7 |
| Distinct categories | 3 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | hSpCas9 |
|---|---|
| 2nd row | hSpCas9 |
| 3rd row | hSpCas9 |
| 4th row | hSpCas9 |
| 5th row | hSpCas9 |
Common Values
| Value | Count | Frequency (%) |
| hSpCas9 | 20000 |
Length
Category Frequency Plot
| Value | Count | Frequency (%) |
| hspcas9 | 20000 |
Most occurring characters
| Value | Count | Frequency (%) |
| h | 20000 | |
| S | 20000 | |
| p | 20000 | |
| C | 20000 | |
| a | 20000 | |
| s | 20000 | |
| 9 | 20000 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 80000 | |
| Uppercase Letter | 40000 | |
| Decimal Number | 20000 | 14.3% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| h | 20000 | |
| p | 20000 | |
| a | 20000 | |
| s | 20000 |
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 20000 | |
| C | 20000 |
Decimal Number
| Value | Count | Frequency (%) |
| 9 | 20000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 120000 | |
| Common | 20000 | 14.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| h | 20000 | |
| S | 20000 | |
| p | 20000 | |
| C | 20000 | |
| a | 20000 | |
| s | 20000 |
Common
| Value | Count | Frequency (%) |
| 9 | 20000 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 140000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| h | 20000 | |
| S | 20000 | |
| p | 20000 | |
| C | 20000 | |
| a | 20000 | |
| s | 20000 | |
| 9 | 20000 |
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| negative selection |
|---|
Length
| Max length | 18 |
|---|---|
| Median length | 18 |
| Mean length | 18 |
| Min length | 18 |
Characters and Unicode
| Total characters | 360000 |
|---|---|
| Distinct characters | 12 |
| Distinct categories | 2 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | negative selection |
|---|---|
| 2nd row | negative selection |
| 3rd row | negative selection |
| 4th row | negative selection |
| 5th row | negative selection |
Common Values
| Value | Count | Frequency (%) |
| negative selection | 20000 |
Length
Category Frequency Plot
| Value | Count | Frequency (%) |
| negative | 20000 | |
| selection | 20000 |
Most occurring characters
| Value | Count | Frequency (%) |
| e | 80000 | |
| n | 40000 | |
| t | 40000 | |
| i | 40000 | |
| g | 20000 | 5.6% |
| a | 20000 | 5.6% |
| v | 20000 | 5.6% |
| 20000 | 5.6% | |
| s | 20000 | 5.6% |
| l | 20000 | 5.6% |
| Other values (2) | 40000 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 340000 | |
| Space Separator | 20000 | 5.6% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 80000 | |
| n | 40000 | |
| t | 40000 | |
| i | 40000 | |
| g | 20000 | 5.9% |
| a | 20000 | 5.9% |
| v | 20000 | 5.9% |
| s | 20000 | 5.9% |
| l | 20000 | 5.9% |
| c | 20000 | 5.9% |
Space Separator
| Value | Count | Frequency (%) |
| 20000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 340000 | |
| Common | 20000 | 5.6% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 80000 | |
| n | 40000 | |
| t | 40000 | |
| i | 40000 | |
| g | 20000 | 5.9% |
| a | 20000 | 5.9% |
| v | 20000 | 5.9% |
| s | 20000 | 5.9% |
| l | 20000 | 5.9% |
| c | 20000 | 5.9% |
Common
| Value | Count | Frequency (%) |
| 20000 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 360000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| e | 80000 | |
| n | 40000 | |
| t | 40000 | |
| i | 40000 | |
| g | 20000 | 5.6% |
| a | 20000 | 5.6% |
| v | 20000 | 5.6% |
| 20000 | 5.6% | |
| s | 20000 | 5.6% |
| l | 20000 | 5.6% |
| Other values (2) | 40000 |
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| Jiyoye |
|---|
Length
| Max length | 6 |
|---|---|
| Median length | 6 |
| Mean length | 6 |
| Min length | 6 |
Characters and Unicode
| Total characters | 120000 |
|---|---|
| Distinct characters | 5 |
| Distinct categories | 2 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | Jiyoye |
|---|---|
| 2nd row | Jiyoye |
| 3rd row | Jiyoye |
| 4th row | Jiyoye |
| 5th row | Jiyoye |
Common Values
| Value | Count | Frequency (%) |
| Jiyoye | 20000 |
Length
Category Frequency Plot
| Value | Count | Frequency (%) |
| jiyoye | 20000 |
Most occurring characters
| Value | Count | Frequency (%) |
| y | 40000 | |
| J | 20000 | |
| i | 20000 | |
| o | 20000 | |
| e | 20000 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 100000 | |
| Uppercase Letter | 20000 | 16.7% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| y | 40000 | |
| i | 20000 | |
| o | 20000 | |
| e | 20000 |
Uppercase Letter
| Value | Count | Frequency (%) |
| J | 20000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 120000 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| y | 40000 | |
| J | 20000 | |
| i | 20000 | |
| o | 20000 | |
| e | 20000 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 120000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| y | 40000 | |
| J | 20000 | |
| i | 20000 | |
| o | 20000 | |
| e | 20000 |
| Distinct | 1378 |
|---|---|
| Distinct (%) | 6.9% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 0.6260735334 |
| Minimum | 1.248735335 × 10-5 |
|---|---|
| Maximum | 0.9999813664 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 156.4 KiB |
Quantile statistics
| Minimum | 1.248735335 × 10-5 |
|---|---|
| 5-th percentile | 0.0117820868 |
| Q1 | 0.4176767223 |
| median | 0.7141961313 |
| Q3 | 0.8857393361 |
| 95-th percentile | 0.9832672947 |
| Maximum | 0.9999813664 |
| Range | 0.999968879 |
| Interquartile range (IQR) | 0.4680626138 |
Descriptive statistics
| Standard deviation | 0.3051406301 |
|---|---|
| Coefficient of variation (CV) | 0.4873878447 |
| Kurtosis | -0.7156432969 |
| Mean | 0.6260735334 |
| Median Absolute Deviation (MAD) | 0.2061126918 |
| Skewness | -0.6982329418 |
| Sum | 12521.47067 |
| Variance | 0.09311080414 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 0.897696761 | 126 | 0.6% |
| 0.5215339035 | 100 | 0.5% |
| 0.9726951334 | 92 | 0.5% |
| 0.03309504096 | 90 | 0.4% |
| 0.9909719195 | 81 | 0.4% |
| 0.4262849916 | 81 | 0.4% |
| 0.8766792768 | 80 | 0.4% |
| 0.9228333843 | 80 | 0.4% |
| 0.2221949719 | 79 | 0.4% |
| 0.9912707955 | 78 | 0.4% |
| Other values (1368) | 19113 |
| Value | Count | Frequency (%) |
| 1.248735335 × 10-5 | 10 | |
| 1.656722788 × 10-5 | 19 | |
| 2.533789228 × 10-5 | 10 | |
| 2.752990342 × 10-5 | 10 | |
| 2.763798739 × 10-5 | 10 | |
| 2.959303515 × 10-5 | 10 | |
| 3.073828034 × 10-5 | 10 | |
| 3.605121453 × 10-5 | 10 | |
| 3.853987714 × 10-5 | 1 | < 0.1% |
| 4.495479604 × 10-5 | 10 |
| Value | Count | Frequency (%) |
| 0.9999813664 | 65 | |
| 0.9998111765 | 10 | 0.1% |
| 0.9997012286 | 6 | < 0.1% |
| 0.9989142831 | 2 | < 0.1% |
| 0.9987868647 | 70 | |
| 0.9986261462 | 10 | 0.1% |
| 0.9984412016 | 50 | |
| 0.9982535696 | 10 | 0.1% |
| 0.998175766 | 20 | 0.1% |
| 0.9980702928 | 10 | 0.1% |
| Distinct | 2 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 19.7 KiB |
| False | |
|---|---|
| True | 1605 |
| Value | Count | Frequency (%) |
| False | 18395 | |
| True | 1605 | 8.0% |
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| viability |
|---|
Length
| Max length | 9 |
|---|---|
| Median length | 9 |
| Mean length | 9 |
| Min length | 9 |
Characters and Unicode
| Total characters | 180000 |
|---|---|
| Distinct characters | 7 |
| Distinct categories | 1 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | viability |
|---|---|
| 2nd row | viability |
| 3rd row | viability |
| 4th row | viability |
| 5th row | viability |
Common Values
| Value | Count | Frequency (%) |
| viability | 20000 |
Length
Category Frequency Plot
| Value | Count | Frequency (%) |
| viability | 20000 |
Most occurring characters
| Value | Count | Frequency (%) |
| i | 60000 | |
| v | 20000 | 11.1% |
| a | 20000 | 11.1% |
| b | 20000 | 11.1% |
| l | 20000 | 11.1% |
| t | 20000 | 11.1% |
| y | 20000 | 11.1% |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 180000 |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| i | 60000 | |
| v | 20000 | 11.1% |
| a | 20000 | 11.1% |
| b | 20000 | 11.1% |
| l | 20000 | 11.1% |
| t | 20000 | 11.1% |
| y | 20000 | 11.1% |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 180000 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| i | 60000 | |
| v | 20000 | 11.1% |
| a | 20000 | 11.1% |
| b | 20000 | 11.1% |
| l | 20000 | 11.1% |
| t | 20000 | 11.1% |
| y | 20000 | 11.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 180000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| i | 60000 | |
| v | 20000 | 11.1% |
| a | 20000 | 11.1% |
| b | 20000 | 11.1% |
| l | 20000 | 11.1% |
| t | 20000 | 11.1% |
| y | 20000 | 11.1% |
| Distinct | 2083 |
|---|---|
| Distinct (%) | 10.4% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| ANKRD20A4::ENSG00000172014 | 36 |
|---|---|
| ANKRD20A3::ENSG00000276203 | 34 |
| BPY2C::ENSG00000185894 | 30 |
| AMY1B::ENSG00000174876 | 30 |
| AMY1A::ENSG00000237763 | 30 |
| Other values (2078) |
Length
| Max length | 32 |
|---|---|
| Median length | 30 |
| Mean length | 22.76775 |
| Min length | 19 |
Characters and Unicode
| Total characters | 455355 |
|---|---|
| Distinct characters | 41 |
| Distinct categories | 5 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 38 ? |
|---|---|
| Unique (%) | 0.2% |
Sample
| 1st row | A1CF::ENSG00000148584 |
|---|---|
| 2nd row | A1CF::ENSG00000148584 |
| 3rd row | A1CF::ENSG00000148584 |
| 4th row | A1CF::ENSG00000148584 |
| 5th row | A1CF::ENSG00000148584 |
Common Values
| Value | Count | Frequency (%) |
| ANKRD20A4::ENSG00000172014 | 36 | 0.2% |
| ANKRD20A3::ENSG00000276203 | 34 | 0.2% |
| BPY2C::ENSG00000185894 | 30 | 0.1% |
| AMY1B::ENSG00000174876 | 30 | 0.1% |
| AMY1A::ENSG00000237763 | 30 | 0.1% |
| AMY1C::ENSG00000187733 | 30 | 0.1% |
| BPY2B::ENSG00000183795 | 30 | 0.1% |
| BPY2::ENSG00000183753 | 30 | 0.1% |
| ANKRD20A2::ENSG00000183148 | 29 | 0.1% |
| AKR1C1::ENSG00000187134 | 25 | 0.1% |
| Other values (2073) | 19696 |
Length
| Value | Count | Frequency (%) |
| ankrd20a4::ensg00000172014 | 36 | 0.2% |
| ankrd20a3::ensg00000276203 | 34 | 0.2% |
| bpy2c::ensg00000185894 | 30 | 0.1% |
| amy1a::ensg00000237763 | 30 | 0.1% |
| amy1c::ensg00000187733 | 30 | 0.1% |
| bpy2b::ensg00000183795 | 30 | 0.1% |
| bpy2::ensg00000183753 | 30 | 0.1% |
| amy1b::ensg00000174876 | 30 | 0.1% |
| ankrd20a2::ensg00000183148 | 29 | 0.1% |
| akr1c1::ensg00000187134 | 25 | 0.1% |
| Other values (2073) | 19696 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 113439 | |
| : | 40000 | 8.8% |
| 1 | 35029 | 7.7% |
| G | 22765 | 5.0% |
| N | 22611 | 5.0% |
| S | 22243 | 4.9% |
| E | 21290 | 4.7% |
| A | 18588 | 4.1% |
| 2 | 17879 | 3.9% |
| 3 | 13891 | 3.1% |
| Other values (31) | 127620 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 251032 | |
| Uppercase Letter | 155977 | |
| Other Punctuation | 40000 | 8.8% |
| Lowercase Letter | 8247 | 1.8% |
| Dash Punctuation | 99 | < 0.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| G | 22765 | |
| N | 22611 | |
| S | 22243 | |
| E | 21290 | |
| A | 18588 | |
| C | 7459 | 4.8% |
| B | 6795 | 4.4% |
| P | 5158 | 3.3% |
| R | 4662 | 3.0% |
| T | 4253 | 2.7% |
| Other values (16) | 20153 |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 113439 | |
| 1 | 35029 | 14.0% |
| 2 | 17879 | 7.1% |
| 3 | 13891 | 5.5% |
| 6 | 13159 | 5.2% |
| 7 | 12865 | 5.1% |
| 4 | 12308 | 4.9% |
| 5 | 11375 | 4.5% |
| 8 | 11303 | 4.5% |
| 9 | 9784 | 3.9% |
Lowercase Letter
| Value | Count | Frequency (%) |
| o | 2749 | |
| r | 2749 | |
| f | 2749 |
Other Punctuation
| Value | Count | Frequency (%) |
| : | 40000 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 99 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 291131 | |
| Latin | 164224 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| G | 22765 | |
| N | 22611 | |
| S | 22243 | |
| E | 21290 | |
| A | 18588 | |
| C | 7459 | 4.5% |
| B | 6795 | 4.1% |
| P | 5158 | 3.1% |
| R | 4662 | 2.8% |
| T | 4253 | 2.6% |
| Other values (19) | 28400 |
Common
| Value | Count | Frequency (%) |
| 0 | 113439 | |
| : | 40000 | 13.7% |
| 1 | 35029 | 12.0% |
| 2 | 17879 | 6.1% |
| 3 | 13891 | 4.8% |
| 6 | 13159 | 4.5% |
| 7 | 12865 | 4.4% |
| 4 | 12308 | 4.2% |
| 5 | 11375 | 3.9% |
| 8 | 11303 | 3.9% |
| Other values (2) | 9883 | 3.4% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 455355 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 113439 | |
| : | 40000 | 8.8% |
| 1 | 35029 | 7.7% |
| G | 22765 | 5.0% |
| N | 22611 | 5.0% |
| S | 22243 | 4.9% |
| E | 21290 | 4.7% |
| A | 18588 | 4.1% |
| 2 | 17879 | 3.9% |
| 3 | 13891 | 3.1% |
| Other values (31) | 127620 |
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
|---|
Length
| Max length | 584 |
|---|---|
| Median length | 584 |
| Mean length | 584 |
| Min length | 584 |
Characters and Unicode
| Total characters | 11680000 |
|---|---|
| Distinct characters | 15 |
| Distinct categories | 5 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
|---|---|
| 2nd row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
| 3rd row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
| 4th row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
| 5th row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
Common Values
| Value | Count | Frequency (%) |
| [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 20000 |
Length
Category Frequency Plot
| Value | Count | Frequency (%) |
| 0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07 | 20000 |
Most occurring characters
| Value | Count | Frequency (%) |
| , | 1980000 | |
| . | 1920000 | |
| 0 | 1800000 | |
| [ | 1020000 | |
| ] | 1020000 | |
| 1 | 840000 | |
| 4 | 540000 | 4.6% |
| 5 | 440000 | 3.8% |
| 2 | 440000 | 3.8% |
| 3 | 380000 | 3.3% |
| Other values (5) | 1300000 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 5700000 | |
| Other Punctuation | 3900000 | |
| Open Punctuation | 1020000 | 8.7% |
| Close Punctuation | 1020000 | 8.7% |
| Dash Punctuation | 40000 | 0.3% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 1800000 | |
| 1 | 840000 | |
| 4 | 540000 | 9.5% |
| 5 | 440000 | 7.7% |
| 2 | 440000 | 7.7% |
| 3 | 380000 | 6.7% |
| 6 | 340000 | 6.0% |
| 8 | 340000 | 6.0% |
| 9 | 300000 | 5.3% |
| 7 | 280000 | 4.9% |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 1980000 | |
| . | 1920000 |
Open Punctuation
| Value | Count | Frequency (%) |
| [ | 1020000 |
Close Punctuation
| Value | Count | Frequency (%) |
| ] | 1020000 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 40000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 11680000 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| , | 1980000 | |
| . | 1920000 | |
| 0 | 1800000 | |
| [ | 1020000 | |
| ] | 1020000 | |
| 1 | 840000 | |
| 4 | 540000 | 4.6% |
| 5 | 440000 | 3.8% |
| 2 | 440000 | 3.8% |
| 3 | 380000 | 3.3% |
| Other values (5) | 1300000 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 11680000 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| , | 1980000 | |
| . | 1920000 | |
| 0 | 1800000 | |
| [ | 1020000 | |
| ] | 1020000 | |
| 1 | 840000 | |
| 4 | 540000 | 4.6% |
| 5 | 440000 | 3.8% |
| 2 | 440000 | 3.8% |
| 3 | 380000 | 3.3% |
| Other values (5) | 1300000 |
| Distinct | 19 |
|---|---|
| Distinct (%) | 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 0.62725 |
| Minimum | -9 |
|---|---|
| Maximum | 9 |
| Zeros | 2043 |
| Zeros (%) | 10.2% |
| Negative | 7930 |
| Negative (%) | 39.6% |
| Memory size | 156.4 KiB |
Quantile statistics
| Minimum | -9 |
|---|---|
| 5-th percentile | -8 |
| Q1 | -4 |
| median | 1 |
| Q3 | 5 |
| 95-th percentile | 9 |
| Maximum | 9 |
| Range | 18 |
| Interquartile range (IQR) | 9 |
Descriptive statistics
| Standard deviation | 5.200486486 |
|---|---|
| Coefficient of variation (CV) | 8.290931026 |
| Kurtosis | -1.059658099 |
| Mean | 0.62725 |
| Median Absolute Deviation (MAD) | 4 |
| Skewness | -0.1165224787 |
| Sum | 12545 |
| Variance | 27.04505969 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 0 | 2043 | 10.2% |
| 7 | 1142 | 5.7% |
| 5 | 1135 | 5.7% |
| 9 | 1135 | 5.7% |
| 4 | 1117 | 5.6% |
| 3 | 1114 | 5.6% |
| 8 | 1108 | 5.5% |
| 2 | 1102 | 5.5% |
| 1 | 1100 | 5.5% |
| 6 | 1074 | 5.4% |
| Other values (9) | 7930 |
| Value | Count | Frequency (%) |
| -9 | 665 | 3.3% |
| -8 | 721 | 3.6% |
| -7 | 893 | |
| -6 | 973 | |
| -5 | 902 | |
| -4 | 925 | |
| -3 | 962 | |
| -2 | 934 | |
| -1 | 955 | |
| 0 | 2043 |
| Value | Count | Frequency (%) |
| 9 | 1135 | |
| 8 | 1108 | |
| 7 | 1142 | |
| 6 | 1074 | |
| 5 | 1135 | |
| 4 | 1117 | |
| 3 | 1114 | |
| 2 | 1102 | |
| 1 | 1100 | |
| 0 | 2043 |
| Distinct | 643 |
|---|---|
| Distinct (%) | 3.2% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| [0] | 745 |
|---|---|
| [77] | 126 |
| [65] | 111 |
| [61] | 110 |
| [120] | 104 |
| Other values (638) |
Length
| Max length | 6 |
|---|---|
| Median length | 5 |
| Mean length | 4.5367 |
| Min length | 3 |
Characters and Unicode
| Total characters | 90734 |
|---|---|
| Distinct characters | 12 |
| Distinct categories | 3 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 97 ? |
|---|---|
| Unique (%) | 0.5% |
Sample
| 1st row | [260] |
|---|---|
| 2nd row | [17] |
| 3rd row | [75] |
| 4th row | [47] |
| 5th row | [58] |
Common Values
| Value | Count | Frequency (%) |
| [0] | 745 | 3.7% |
| [77] | 126 | 0.6% |
| [65] | 111 | 0.6% |
| [61] | 110 | 0.5% |
| [120] | 104 | 0.5% |
| [74] | 103 | 0.5% |
| [102] | 102 | 0.5% |
| [38] | 101 | 0.5% |
| [69] | 100 | 0.5% |
| [97] | 100 | 0.5% |
| Other values (633) | 18298 |
Length
| Value | Count | Frequency (%) |
| 0 | 745 | 3.7% |
| 77 | 126 | 0.6% |
| 65 | 111 | 0.6% |
| 61 | 110 | 0.5% |
| 120 | 104 | 0.5% |
| 74 | 103 | 0.5% |
| 102 | 102 | 0.5% |
| 38 | 101 | 0.5% |
| 69 | 100 | 0.5% |
| 97 | 100 | 0.5% |
| Other values (633) | 18298 |
Most occurring characters
| Value | Count | Frequency (%) |
| [ | 20000 | |
| ] | 20000 | |
| 1 | 10739 | |
| 2 | 7330 | 8.1% |
| 3 | 5127 | 5.7% |
| 0 | 4306 | 4.7% |
| 4 | 4290 | 4.7% |
| 5 | 4131 | 4.6% |
| 7 | 3871 | 4.3% |
| 6 | 3825 | 4.2% |
| Other values (2) | 7115 | 7.8% |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 50734 | |
| Open Punctuation | 20000 | 22.0% |
| Close Punctuation | 20000 | 22.0% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 10739 | |
| 2 | 7330 | |
| 3 | 5127 | |
| 0 | 4306 | |
| 4 | 4290 | 8.5% |
| 5 | 4131 | 8.1% |
| 7 | 3871 | 7.6% |
| 6 | 3825 | 7.5% |
| 8 | 3595 | 7.1% |
| 9 | 3520 | 6.9% |
Open Punctuation
| Value | Count | Frequency (%) |
| [ | 20000 |
Close Punctuation
| Value | Count | Frequency (%) |
| ] | 20000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 90734 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| [ | 20000 | |
| ] | 20000 | |
| 1 | 10739 | |
| 2 | 7330 | 8.1% |
| 3 | 5127 | 5.7% |
| 0 | 4306 | 4.7% |
| 4 | 4290 | 4.7% |
| 5 | 4131 | 4.6% |
| 7 | 3871 | 4.3% |
| 6 | 3825 | 4.2% |
| Other values (2) | 7115 | 7.8% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 90734 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| [ | 20000 | |
| ] | 20000 | |
| 1 | 10739 | |
| 2 | 7330 | 8.1% |
| 3 | 5127 | 5.7% |
| 0 | 4306 | 4.7% |
| 4 | 4290 | 4.7% |
| 5 | 4131 | 4.6% |
| 7 | 3871 | 4.3% |
| 6 | 3825 | 4.2% |
| Other values (2) | 7115 | 7.8% |
| Distinct | 548 |
|---|---|
| Distinct (%) | 2.7% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 156.4 KiB |
| [0] | 253 |
|---|---|
| [75] | 141 |
| [35] | 136 |
| [25] | 132 |
| [36] | 130 |
| Other values (543) |
Length
| Max length | 6 |
|---|---|
| Median length | 5 |
| Mean length | 4.42495 |
| Min length | 3 |
Characters and Unicode
| Total characters | 88499 |
|---|---|
| Distinct characters | 12 |
| Distinct categories | 3 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 84 ? |
|---|---|
| Unique (%) | 0.4% |
Sample
| 1st row | [244] |
|---|---|
| 2nd row | [59] |
| 3rd row | [153] |
| 4th row | [105] |
| 5th row | [57] |
Common Values
| Value | Count | Frequency (%) |
| [0] | 253 | 1.3% |
| [75] | 141 | 0.7% |
| [35] | 136 | 0.7% |
| [25] | 132 | 0.7% |
| [36] | 130 | 0.7% |
| [27] | 128 | 0.6% |
| [47] | 128 | 0.6% |
| [76] | 127 | 0.6% |
| [80] | 127 | 0.6% |
| [50] | 126 | 0.6% |
| Other values (538) | 18572 |
Length
| Value | Count | Frequency (%) |
| 0 | 253 | 1.3% |
| 75 | 141 | 0.7% |
| 35 | 136 | 0.7% |
| 25 | 132 | 0.7% |
| 36 | 130 | 0.7% |
| 47 | 128 | 0.6% |
| 27 | 128 | 0.6% |
| 76 | 127 | 0.6% |
| 80 | 127 | 0.6% |
| 50 | 126 | 0.6% |
| Other values (538) | 18572 |
Most occurring characters
| Value | Count | Frequency (%) |
| [ | 20000 | |
| ] | 20000 | |
| 1 | 10644 | |
| 2 | 6345 | 7.2% |
| 3 | 4887 | 5.5% |
| 4 | 4249 | 4.8% |
| 5 | 4166 | 4.7% |
| 6 | 3863 | 4.4% |
| 7 | 3828 | 4.3% |
| 0 | 3588 | 4.1% |
| Other values (2) | 6929 | 7.8% |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 48499 | |
| Open Punctuation | 20000 | |
| Close Punctuation | 20000 |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 10644 | |
| 2 | 6345 | |
| 3 | 4887 | |
| 4 | 4249 | 8.8% |
| 5 | 4166 | 8.6% |
| 6 | 3863 | 8.0% |
| 7 | 3828 | 7.9% |
| 0 | 3588 | 7.4% |
| 9 | 3476 | 7.2% |
| 8 | 3453 | 7.1% |
Open Punctuation
| Value | Count | Frequency (%) |
| [ | 20000 |
Close Punctuation
| Value | Count | Frequency (%) |
| ] | 20000 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 88499 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| [ | 20000 | |
| ] | 20000 | |
| 1 | 10644 | |
| 2 | 6345 | 7.2% |
| 3 | 4887 | 5.5% |
| 4 | 4249 | 4.8% |
| 5 | 4166 | 4.7% |
| 6 | 3863 | 4.4% |
| 7 | 3828 | 4.3% |
| 0 | 3588 | 4.1% |
| Other values (2) | 6929 | 7.8% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 88499 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| [ | 20000 | |
| ] | 20000 | |
| 1 | 10644 | |
| 2 | 6345 | 7.2% |
| 3 | 4887 | 5.5% |
| 4 | 4249 | 4.8% |
| 5 | 4166 | 4.7% |
| 6 | 3863 | 4.4% |
| 7 | 3828 | 4.3% |
| 0 | 3588 | 4.1% |
| Other values (2) | 6929 | 7.8% |
Spearman's ρ
The Spearman's rank correlation coefficient (ρ) is a measure of monotonic correlation between two variables, and is therefore better in catching nonlinear monotonic correlations than Pearson's r. It's value lies between -1 and +1, -1 indicating total negative monotonic correlation, 0 indicating no monotonic correlation and 1 indicating total positive monotonic correlation.To calculate ρ for two variables X and Y, one divides the covariance of the rank variables of X and Y by the product of their standard deviations.
Pearson's r
The Pearson's correlation coefficient (r) is a measure of linear correlation between two variables. It's value lies between -1 and +1, -1 indicating total negative linear correlation, 0 indicating no linear correlation and 1 indicating total positive linear correlation. Furthermore, r is invariant under separate changes in location and scale of the two variables, implying that for a linear function the angle to the x-axis does not affect r.To calculate r for two variables X and Y, one divides the covariance of X and Y by the product of their standard deviations.
Kendall's τ
Similarly to Spearman's rank correlation coefficient, the Kendall rank correlation coefficient (τ) measures ordinal association between two variables. It's value lies between -1 and +1, -1 indicating total negative correlation, 0 indicating no correlation and 1 indicating total positive correlation.To calculate τ for two variables X and Y, one determines the number of concordant and discordant pairs of observations. τ is given by the number of concordant pairs minus the discordant pairs divided by the total number of pairs.
Cramér's V (φc)
Cramér's V is an association measure for nominal random variables. The coefficient ranges from 0 to 1, with 0 indicating independence and 1 indicating perfect association. The empirical estimators used for Cramér's V have been proved to be biased, even for large samples. We use a bias-corrected measure that has been proposed by Bergsma in 2013 that can be found here.Phik (φk)
Phik (φk) is a new and practical correlation coefficient that works consistently between categorical, ordinal and interval variables, captures non-linear dependency and reverts to the Pearson correlation coefficient in case of a bivariate normal input distribution. There is extensive documentation available here.First rows
| Unnamed: 0 | name | log2fc | chr | start | end | ensg | symbol | sequence | strand | pubmed | cas | screentype | cellline | score | hit | condition | genetargets | scoredist | effect | rc_initial | rc_final | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0 | sgA1CF_1 | 0.315907 | 10 | 50844073 | 50844096 | ENSG00000148584 | A1CF | GCAGCATCCCAACCAGGTGGAGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 2 | [260] | [244] |
| 1 | 1 | sgA1CF_10 | 2.144141 | 10 | 50814011 | 50814034 | ENSG00000148584 | A1CF | GCGGGAGTGAGAGGACTGGGCGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 9 | [17] | [59] |
| 2 | 2 | sgA1CF_2 | 1.426034 | 10 | 50836111 | 50836134 | ENSG00000148584 | A1CF | ATGACTCTCATACTCCACGAAGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 8 | [75] | [153] |
| 3 | 3 | sgA1CF_3 | 1.550133 | 10 | 50836095 | 50836118 | ENSG00000148584 | A1CF | GAGTCATCGAGCAGCTGCCATGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 8 | [47] | [105] |
| 4 | 4 | sgA1CF_4 | 0.382513 | 10 | 50816234 | 50816257 | ENSG00000148584 | A1CF | AGTCACCCTAGCAAAACCAGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [58] | [57] |
| 5 | 5 | sgA1CF_5 | 0.993477 | 10 | 50816119 | 50816142 | ENSG00000148584 | A1CF | GATCCCACCACAACCTACCTTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 6 | [358] | [538] |
| 6 | 6 | sgA1CF_6 | 0.407175 | 10 | 50815998 | 50816021 | ENSG00000148584 | A1CF | GGTGTTACCTCTAACAGAAGGGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [0] | [0] |
| 7 | 7 | sgA1CF_7 | 2.992138 | 10 | 50810020 | 50810043 | ENSG00000148584 | A1CF | GCTTTGGAGGTGTGAAAGGGTGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 9 | [1] | [11] |
| 8 | 8 | sgA1CF_8 | 0.431221 | 10 | 50813861 | 50813884 | ENSG00000148584 | A1CF | GGAGCGAGTTTAATTCCTTGGGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [118] | [120] |
| 9 | 9 | sgA1CF_9 | -1.101838 | 10 | 50816142 | 50816165 | ENSG00000148584 | A1CF | ATAAACTTGGCCCAAAGAGTAGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -6 | [36] | [12] |
Last rows
| Unnamed: 0 | name | log2fc | chr | start | end | ensg | symbol | sequence | strand | pubmed | cas | screentype | cellline | score | hit | condition | genetargets | scoredist | effect | rc_initial | rc_final | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 19990 | 19990 | sgC2orf70_2 | 0.656535 | 2 | 26575958 | 26575981 | ENSG00000173557 | C2orf70 | GTCCTGGAAGTACTTGAGGGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 5 | [105] | [125] |
| 19991 | 19991 | sgC2orf70_3 | -1.933249 | 2 | 26576039 | 26576062 | ENSG00000173557 | C2orf70 | GGGGTTGGTGGAGAAGATGGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -8 | [156] | [30] |
| 19992 | 19992 | sgC2orf70_4 | 1.468576 | 2 | 26577619 | 26577642 | ENSG00000173557 | C2orf70 | GGCAGGCACTCACAGGACGGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 8 | [68] | [143] |
| 19993 | 19993 | sgC2orf70_5 | 2.756325 | 2 | 26575919 | 26575942 | ENSG00000173557 | C2orf70 | GCCAAAGGAGAAGGCCACAGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 9 | [20] | [106] |
| 19994 | 19994 | sgC2orf70_6 | 0.915787 | 2 | 26562621 | 26562644 | ENSG00000173557 | C2orf70 | TCAGTAGGGTGCCCGCGCTGCGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 6 | [96] | [137] |
| 19995 | 19995 | sgC2orf70_7 | -1.496395 | 2 | 26562668 | 26562691 | ENSG00000173557 | C2orf70 | TTACCCGGGCATGAGTCCAGGGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -7 | [216] | [57] |
| 19996 | 19996 | sgC2orf70_8 | 0.392748 | 2 | 26576142 | 26576165 | ENSG00000173557 | C2orf70 | TCGTAAGCTCTGTGGAGCGATGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [200] | [198] |
| 19997 | 19997 | sgC2orf70_9 | 0.049623 | 2 | 26562610 | 26562633 | ENSG00000173557 | C2orf70 | ACCATGGCCTCCCGCAGCGCGGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 0 | [327] | [255] |
| 19998 | 19998 | sgC2orf71_1 | 0.537572 | 2 | 29073827 | 29073850 | ENSG00000179270 | C2orf71 | GTACCCAAGATACTTCCAAATGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.980295 | False | viability | C2orf71::ENSG00000179270 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 4 | [221] | [242] |
| 19999 | 19999 | sgC2orf71_10 | -0.501271 | 2 | 29072182 | 29072205 | ENSG00000179270 | C2orf71 | GAAATGCAATCCCCATCCTGAGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.980295 | False | viability | C2orf71::ENSG00000179270 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -4 | [579] | [308] |