Dataset statistics
Number of variables | 22 |
---|---|
Number of observations | 20000 |
Missing cells | 0 |
Missing cells (%) | 0.0% |
Duplicate rows | 0 |
Duplicate rows (%) | 0.0% |
Total size in memory | 3.2 MiB |
Average record size in memory | 169.0 B |
Variable types
Numeric | 6 |
---|---|
Categorical | 15 |
Boolean | 1 |
pubmed has constant value "26472758" | Constant |
cas has constant value "hSpCas9" | Constant |
screentype has constant value "negative selection" | Constant |
cellline has constant value "Jiyoye" | Constant |
condition has constant value "viability" | Constant |
scoredist has constant value "[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]" | Constant |
name has a high cardinality: 18459 distinct values | High cardinality |
chr has a high cardinality: 70 distinct values | High cardinality |
ensg has a high cardinality: 2083 distinct values | High cardinality |
symbol has a high cardinality: 1956 distinct values | High cardinality |
sequence has a high cardinality: 18349 distinct values | High cardinality |
genetargets has a high cardinality: 2083 distinct values | High cardinality |
rc_initial has a high cardinality: 643 distinct values | High cardinality |
rc_final has a high cardinality: 548 distinct values | High cardinality |
log2fc is highly correlated with effect | High correlation |
start is highly correlated with end | High correlation |
end is highly correlated with start | High correlation |
effect is highly correlated with log2fc | High correlation |
log2fc is highly correlated with effect | High correlation |
start is highly correlated with end | High correlation |
end is highly correlated with start | High correlation |
score is highly correlated with hit | High correlation |
hit is highly correlated with score | High correlation |
effect is highly correlated with log2fc | High correlation |
log2fc is highly correlated with effect | High correlation |
start is highly correlated with end | High correlation |
end is highly correlated with start | High correlation |
effect is highly correlated with log2fc | High correlation |
strand is highly correlated with pubmed and 5 other fields | High correlation |
pubmed is highly correlated with strand and 7 other fields | High correlation |
cas is highly correlated with strand and 7 other fields | High correlation |
condition is highly correlated with strand and 7 other fields | High correlation |
scoredist is highly correlated with strand and 7 other fields | High correlation |
cellline is highly correlated with strand and 7 other fields | High correlation |
screentype is highly correlated with strand and 7 other fields | High correlation |
hit is highly correlated with pubmed and 5 other fields | High correlation |
chr is highly correlated with pubmed and 5 other fields | High correlation |
Unnamed: 0 is highly correlated with chr | High correlation |
log2fc is highly correlated with effect | High correlation |
chr is highly correlated with Unnamed: 0 and 3 other fields | High correlation |
start is highly correlated with chr and 1 other fields | High correlation |
end is highly correlated with chr and 1 other fields | High correlation |
score is highly correlated with chr and 1 other fields | High correlation |
hit is highly correlated with score | High correlation |
effect is highly correlated with log2fc | High correlation |
Unnamed: 0 is uniformly distributed | Uniform |
name is uniformly distributed | Uniform |
ensg is uniformly distributed | Uniform |
sequence is uniformly distributed | Uniform |
genetargets is uniformly distributed | Uniform |
Unnamed: 0 has unique values | Unique |
effect has 2043 (10.2%) zeros | Zeros |
Reproduction
Analysis started | 2022-06-10 03:11:10.219661 |
---|---|
Analysis finished | 2022-06-10 03:11:18.322254 |
Duration | 8.1 seconds |
Software version | pandas-profiling v3.2.0 |
Download configuration | config.json |
Distinct | 20000 |
---|---|
Distinct (%) | 100.0% |
Missing | 0 |
Missing (%) | 0.0% |
Infinite | 0 |
Infinite (%) | 0.0% |
Mean | 9999.5 |
Minimum | 0 |
---|---|
Maximum | 19999 |
Zeros | 1 |
Zeros (%) | < 0.1% |
Negative | 0 |
Negative (%) | 0.0% |
Memory size | 156.4 KiB |
Quantile statistics
Minimum | 0 |
---|---|
5-th percentile | 999.95 |
Q1 | 4999.75 |
median | 9999.5 |
Q3 | 14999.25 |
95-th percentile | 18999.05 |
Maximum | 19999 |
Range | 19999 |
Interquartile range (IQR) | 9999.5 |
Descriptive statistics
Standard deviation | 5773.647028 |
---|---|
Coefficient of variation (CV) | 0.5773935724 |
Kurtosis | -1.2 |
Mean | 9999.5 |
Median Absolute Deviation (MAD) | 5000 |
Skewness | 0 |
Sum | 199990000 |
Variance | 33335000 |
Monotonicity | Strictly increasing |
Value | Count | Frequency (%) |
0 | 1 | < 0.1% |
13330 | 1 | < 0.1% |
13337 | 1 | < 0.1% |
13336 | 1 | < 0.1% |
13335 | 1 | < 0.1% |
13334 | 1 | < 0.1% |
13333 | 1 | < 0.1% |
13332 | 1 | < 0.1% |
13331 | 1 | < 0.1% |
13329 | 1 | < 0.1% |
Other values (19990) | 19990 |
Value | Count | Frequency (%) |
0 | 1 | |
1 | 1 | |
2 | 1 | |
3 | 1 | |
4 | 1 | |
5 | 1 | |
6 | 1 | |
7 | 1 | |
8 | 1 | |
9 | 1 |
Value | Count | Frequency (%) |
19999 | 1 | |
19998 | 1 | |
19997 | 1 | |
19996 | 1 | |
19995 | 1 | |
19994 | 1 | |
19993 | 1 | |
19992 | 1 | |
19991 | 1 | |
19990 | 1 |
Distinct | 18459 |
---|---|
Distinct (%) | 92.3% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
sgATP6V1G2_1 | 7 |
---|---|
sgABCF1_3 | 7 |
sgABCF1_10 | 7 |
sgABCF1_1 | 7 |
sgAGPAT1_5 | 7 |
Other values (18454) |
Length
Max length | 20 |
---|---|
Median length | 18 |
Mean length | 9.86395 |
Min length | 6 |
Characters and Unicode
Total characters | 197279 |
---|---|
Distinct characters | 43 |
Distinct categories | 5 ? |
Distinct scripts | 2 ? |
Distinct blocks | 1 ? |
Unique
Unique | 17663 ? |
---|---|
Unique (%) | 88.3% |
Sample
1st row | sgA1CF_1 |
---|---|
2nd row | sgA1CF_10 |
3rd row | sgA1CF_2 |
4th row | sgA1CF_3 |
5th row | sgA1CF_4 |
Common Values
Value | Count | Frequency (%) |
sgATP6V1G2_1 | 7 | < 0.1% |
sgABCF1_3 | 7 | < 0.1% |
sgABCF1_10 | 7 | < 0.1% |
sgABCF1_1 | 7 | < 0.1% |
sgAGPAT1_5 | 7 | < 0.1% |
sgAGPAT1_6 | 7 | < 0.1% |
sgAGPAT1_7 | 7 | < 0.1% |
sgAGPAT1_8 | 7 | < 0.1% |
sgATAT1_5 | 7 | < 0.1% |
sgATAT1_4 | 7 | < 0.1% |
Other values (18449) | 19930 |
Length
Value | Count | Frequency (%) |
sgatp6v1g2_1 | 7 | < 0.1% |
sgapom_9 | 7 | < 0.1% |
sgapom_10 | 7 | < 0.1% |
sgapom_2 | 7 | < 0.1% |
sgabcf1_7 | 7 | < 0.1% |
sgabcf1_8 | 7 | < 0.1% |
sgabcf1_9 | 7 | < 0.1% |
sgagpat1_4 | 7 | < 0.1% |
sgagpat1_3 | 7 | < 0.1% |
sgagpat1_2 | 7 | < 0.1% |
Other values (18449) | 19930 |
Most occurring characters
Value | Count | Frequency (%) |
s | 20000 | 10.1% |
g | 20000 | 10.1% |
_ | 20000 | 10.1% |
A | 18827 | 9.5% |
1 | 14821 | 7.5% |
2 | 7580 | 3.8% |
C | 7494 | 3.8% |
B | 6879 | 3.5% |
P | 5027 | 2.5% |
3 | 5006 | 2.5% |
Other values (33) | 71645 |
Most occurring categories
Value | Count | Frequency (%) |
Uppercase Letter | 75697 | |
Decimal Number | 53068 | |
Lowercase Letter | 48463 | |
Connector Punctuation | 20000 | 10.1% |
Dash Punctuation | 51 | < 0.1% |
Most frequent character per category
Uppercase Letter
Value | Count | Frequency (%) |
A | 18827 | |
C | 7494 | 9.9% |
B | 6879 | 9.1% |
P | 5027 | 6.6% |
R | 4653 | 6.1% |
T | 4191 | 5.5% |
D | 3918 | 5.2% |
L | 3466 | 4.6% |
G | 2712 | 3.6% |
N | 2587 | 3.4% |
Other values (16) | 15943 |
Decimal Number
Value | Count | Frequency (%) |
1 | 14821 | |
2 | 7580 | |
3 | 5006 | 9.4% |
4 | 4290 | 8.1% |
5 | 3972 | 7.5% |
6 | 3920 | 7.4% |
7 | 3617 | 6.8% |
0 | 3443 | 6.5% |
9 | 3268 | 6.2% |
8 | 3151 | 5.9% |
Lowercase Letter
Value | Count | Frequency (%) |
s | 20000 | |
g | 20000 | |
f | 2821 | 5.8% |
r | 2821 | 5.8% |
o | 2821 | 5.8% |
Connector Punctuation
Value | Count | Frequency (%) |
_ | 20000 |
Dash Punctuation
Value | Count | Frequency (%) |
- | 51 |
Most occurring scripts
Value | Count | Frequency (%) |
Latin | 124160 | |
Common | 73119 |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
s | 20000 | |
g | 20000 | |
A | 18827 | |
C | 7494 | 6.0% |
B | 6879 | 5.5% |
P | 5027 | 4.0% |
R | 4653 | 3.7% |
T | 4191 | 3.4% |
D | 3918 | 3.2% |
L | 3466 | 2.8% |
Other values (21) | 29705 |
Common
Value | Count | Frequency (%) |
_ | 20000 | |
1 | 14821 | |
2 | 7580 | 10.4% |
3 | 5006 | 6.8% |
4 | 4290 | 5.9% |
5 | 3972 | 5.4% |
6 | 3920 | 5.4% |
7 | 3617 | 4.9% |
0 | 3443 | 4.7% |
9 | 3268 | 4.5% |
Other values (2) | 3202 | 4.4% |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 197279 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
s | 20000 | 10.1% |
g | 20000 | 10.1% |
_ | 20000 | 10.1% |
A | 18827 | 9.5% |
1 | 14821 | 7.5% |
2 | 7580 | 3.8% |
C | 7494 | 3.8% |
B | 6879 | 3.5% |
P | 5027 | 2.5% |
3 | 5006 | 2.5% |
Other values (33) | 71645 |
Distinct | 12525 |
---|---|
Distinct (%) | 62.6% |
Missing | 0 |
Missing (%) | 0.0% |
Infinite | 0 |
Infinite (%) | 0.0% |
Mean | 0.1441097578 |
Minimum | -7.452876964 |
---|---|
Maximum | 7.277540101 |
Zeros | 1 |
Zeros (%) | < 0.1% |
Negative | 8863 |
Negative (%) | 44.3% |
Memory size | 156.4 KiB |
Quantile statistics
Minimum | -7.452876964 |
---|---|
5-th percentile | -1.93677902 |
Q1 | -0.4997152141 |
median | 0.1273343809 |
Q3 | 0.7226772072 |
95-th percentile | 2.261357163 |
Maximum | 7.277540101 |
Range | 14.73041706 |
Interquartile range (IQR) | 1.222392421 |
Descriptive statistics
Standard deviation | 1.431208752 |
---|---|
Coefficient of variation (CV) | 9.931379903 |
Kurtosis | 4.752142078 |
Mean | 0.1441097578 |
Median Absolute Deviation (MAD) | 0.6109299297 |
Skewness | 0.3620742912 |
Sum | 2882.195155 |
Variance | 2.048358492 |
Monotonicity | Not monotonic |
Value | Count | Frequency (%) |
0.4071753815 | 114 | 0.6% |
0.4071753815 | 63 | 0.3% |
2.729103476 | 35 | 0.2% |
0.9921378822 | 33 | 0.2% |
1.992137882 | 32 | 0.2% |
0.4071753815 | 32 | 0.2% |
3.866607 | 30 | 0.1% |
2.407175382 | 29 | 0.1% |
-1.177787119 | 28 | 0.1% |
3.729103476 | 26 | 0.1% |
Other values (12515) | 19578 |
Value | Count | Frequency (%) |
-7.452876964 | 1 | < 0.1% |
-7.387240485 | 1 | < 0.1% |
-7.300183751 | 1 | < 0.1% |
-7.258160536 | 1 | < 0.1% |
-6.963512025 | 1 | < 0.1% |
-6.882843465 | 1 | < 0.1% |
-6.850212461 | 1 | < 0.1% |
-6.811993139 | 1 | < 0.1% |
-6.792496963 | 1 | < 0.1% |
-6.615192432 | 3 |
Value | Count | Frequency (%) |
7.277540101 | 1 | < 0.1% |
7.240065396 | 1 | < 0.1% |
7.175359706 | 2 | |
7.162062884 | 1 | < 0.1% |
7.036532002 | 2 | |
7.021885226 | 1 | < 0.1% |
6.97703099 | 2 | |
6.914970022 | 1 | < 0.1% |
6.899028478 | 3 | |
6.882908812 | 1 | < 0.1% |
Distinct | 70 |
---|---|
Distinct (%) | 0.4% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
1 | |
---|---|
2 | |
11 | |
17 | 1179 |
12 | 1151 |
Other values (65) |
Length
Max length | 24 |
---|---|
Median length | 23 |
Mean length | 2.7003 |
Min length | 1 |
Characters and Unicode
Total characters | 54006 |
---|---|
Distinct characters | 29 |
Distinct categories | 3 ? |
Distinct scripts | 2 ? |
Distinct blocks | 1 ? |
Unique
Unique | 2 ? |
---|---|
Unique (%) | < 0.1% |
Sample
1st row | 10 |
---|---|
2nd row | 10 |
3rd row | 10 |
4th row | 10 |
5th row | 10 |
Common Values
Value | Count | Frequency (%) |
1 | 2168 | 10.8% |
2 | 1300 | 6.5% |
11 | 1299 | 6.5% |
17 | 1179 | 5.9% |
12 | 1151 | 5.8% |
10 | 1132 | 5.7% |
19 | 1063 | 5.3% |
3 | 898 | 4.5% |
7 | 840 | 4.2% |
16 | 790 | 4.0% |
Other values (60) | 8180 |
Length
Value | Count | Frequency (%) |
1 | 2168 | 10.8% |
2 | 1300 | 6.5% |
11 | 1299 | 6.5% |
17 | 1179 | 5.9% |
12 | 1151 | 5.8% |
10 | 1132 | 5.7% |
19 | 1063 | 5.3% |
3 | 898 | 4.5% |
7 | 840 | 4.2% |
16 | 790 | 4.0% |
Other values (60) | 8180 |
Most occurring characters
Value | Count | Frequency (%) |
1 | 13569 | |
C | 4568 | 8.5% |
2 | 4484 | 8.3% |
_ | 4392 | 8.1% |
H | 4345 | 8.0% |
R | 2404 | 4.5% |
7 | 2276 | 4.2% |
6 | 2172 | 4.0% |
9 | 1783 | 3.3% |
0 | 1753 | 3.2% |
Other values (19) | 12260 |
Most occurring categories
Value | Count | Frequency (%) |
Decimal Number | 31021 | |
Uppercase Letter | 18593 | |
Connector Punctuation | 4392 | 8.1% |
Most frequent character per category
Uppercase Letter
Value | Count | Frequency (%) |
C | 4568 | |
H | 4345 | |
R | 2404 | |
S | 1401 | 7.5% |
T | 1324 | 7.1% |
G | 1217 | 6.5% |
M | 918 | 4.9% |
X | 892 | 4.8% |
B | 319 | 1.7% |
O | 234 | 1.3% |
Other values (8) | 971 | 5.2% |
Decimal Number
Value | Count | Frequency (%) |
1 | 13569 | |
2 | 4484 | 14.5% |
7 | 2276 | 7.3% |
6 | 2172 | 7.0% |
9 | 1783 | 5.7% |
0 | 1753 | 5.7% |
4 | 1524 | 4.9% |
5 | 1452 | 4.7% |
3 | 1250 | 4.0% |
8 | 758 | 2.4% |
Connector Punctuation
Value | Count | Frequency (%) |
_ | 4392 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 35413 | |
Latin | 18593 |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
C | 4568 | |
H | 4345 | |
R | 2404 | |
S | 1401 | 7.5% |
T | 1324 | 7.1% |
G | 1217 | 6.5% |
M | 918 | 4.9% |
X | 892 | 4.8% |
B | 319 | 1.7% |
O | 234 | 1.3% |
Other values (8) | 971 | 5.2% |
Common
Value | Count | Frequency (%) |
1 | 13569 | |
2 | 4484 | 12.7% |
_ | 4392 | 12.4% |
7 | 2276 | 6.4% |
6 | 2172 | 6.1% |
9 | 1783 | 5.0% |
0 | 1753 | 5.0% |
4 | 1524 | 4.3% |
5 | 1452 | 4.1% |
3 | 1250 | 3.5% |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 54006 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
1 | 13569 | |
C | 4568 | 8.5% |
2 | 4484 | 8.3% |
_ | 4392 | 8.1% |
H | 4345 | 8.0% |
R | 2404 | 4.5% |
7 | 2276 | 4.2% |
6 | 2172 | 4.0% |
9 | 1783 | 3.3% |
0 | 1753 | 3.2% |
Other values (19) | 12260 |
Distinct | 19498 |
---|---|
Distinct (%) | 97.5% |
Missing | 0 |
Missing (%) | 0.0% |
Infinite | 0 |
Infinite (%) | 0.0% |
Mean | 72761333.22 |
Minimum | 205615 |
---|---|
Maximum | 247112172 |
Zeros | 0 |
Zeros (%) | 0.0% |
Negative | 0 |
Negative (%) | 0.0% |
Memory size | 156.4 KiB |
Quantile statistics
Minimum | 205615 |
---|---|
5-th percentile | 4115365.4 |
Q1 | 31622858.25 |
median | 57631653 |
Q3 | 105548725.5 |
95-th percentile | 185397235.7 |
Maximum | 247112172 |
Range | 246906557 |
Interquartile range (IQR) | 73925867.25 |
Descriptive statistics
Standard deviation | 55829408.96 |
---|---|
Coefficient of variation (CV) | 0.7672950246 |
Kurtosis | 0.3853041092 |
Mean | 72761333.22 |
Median Absolute Deviation (MAD) | 35423902.5 |
Skewness | 0.951766337 |
Sum | 1.455226664 × 1012 |
Variance | 3.116922905 × 1015 |
Monotonicity | Not monotonic |
Value | Count | Frequency (%) |
66127695 | 4 | < 0.1% |
64373607 | 4 | < 0.1% |
64373217 | 4 | < 0.1% |
40226937 | 4 | < 0.1% |
66149287 | 4 | < 0.1% |
67884549 | 4 | < 0.1% |
40248527 | 4 | < 0.1% |
64394801 | 4 | < 0.1% |
66148897 | 4 | < 0.1% |
40227327 | 4 | < 0.1% |
Other values (19488) | 19960 |
Value | Count | Frequency (%) |
205615 | 1 | |
205626 | 1 | |
205637 | 1 | |
205658 | 1 | |
205960 | 1 | |
205978 | 1 | |
205990 | 1 | |
206014 | 1 | |
206031 | 1 | |
207310 | 1 |
Value | Count | Frequency (%) |
247112172 | 1 | |
247112135 | 1 | |
247112092 | 1 | |
247111998 | 1 | |
247111975 | 1 | |
247111836 | 1 | |
247111713 | 1 | |
247111681 | 1 | |
247111620 | 1 | |
247111523 | 1 |
Distinct | 19498 |
---|---|
Distinct (%) | 97.5% |
Missing | 0 |
Missing (%) | 0.0% |
Infinite | 0 |
Infinite (%) | 0.0% |
Mean | 72761356.22 |
Minimum | 205638 |
---|---|
Maximum | 247112195 |
Zeros | 0 |
Zeros (%) | 0.0% |
Negative | 0 |
Negative (%) | 0.0% |
Memory size | 156.4 KiB |
Quantile statistics
Minimum | 205638 |
---|---|
5-th percentile | 4115388.4 |
Q1 | 31622881.25 |
median | 57631676 |
Q3 | 105548748.5 |
95-th percentile | 185397258.7 |
Maximum | 247112195 |
Range | 246906557 |
Interquartile range (IQR) | 73925867.25 |
Descriptive statistics
Standard deviation | 55829408.96 |
---|---|
Coefficient of variation (CV) | 0.767294782 |
Kurtosis | 0.3853041092 |
Mean | 72761356.22 |
Median Absolute Deviation (MAD) | 35423902.5 |
Skewness | 0.951766337 |
Sum | 1.455227124 × 1012 |
Variance | 3.116922905 × 1015 |
Monotonicity | Not monotonic |
Value | Count | Frequency (%) |
66127718 | 4 | < 0.1% |
64373630 | 4 | < 0.1% |
64373240 | 4 | < 0.1% |
40226960 | 4 | < 0.1% |
66149310 | 4 | < 0.1% |
67884572 | 4 | < 0.1% |
40248550 | 4 | < 0.1% |
64394824 | 4 | < 0.1% |
66148920 | 4 | < 0.1% |
40227350 | 4 | < 0.1% |
Other values (19488) | 19960 |
Value | Count | Frequency (%) |
205638 | 1 | |
205649 | 1 | |
205660 | 1 | |
205681 | 1 | |
205983 | 1 | |
206001 | 1 | |
206013 | 1 | |
206037 | 1 | |
206054 | 1 | |
207333 | 1 |
Value | Count | Frequency (%) |
247112195 | 1 | |
247112158 | 1 | |
247112115 | 1 | |
247112021 | 1 | |
247111998 | 1 | |
247111859 | 1 | |
247111736 | 1 | |
247111704 | 1 | |
247111643 | 1 | |
247111546 | 1 |
Distinct | 2083 |
---|---|
Distinct (%) | 10.4% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
ENSG00000172014 | 36 |
---|---|
ENSG00000276203 | 34 |
ENSG00000185894 | 30 |
ENSG00000174876 | 30 |
ENSG00000237763 | 30 |
Other values (2078) |
Length
Max length | 15 |
---|---|
Median length | 15 |
Mean length | 15 |
Min length | 15 |
Characters and Unicode
Total characters | 300000 |
---|---|
Distinct characters | 14 |
Distinct categories | 2 ? |
Distinct scripts | 2 ? |
Distinct blocks | 1 ? |
Unique
Unique | 38 ? |
---|---|
Unique (%) | 0.2% |
Sample
1st row | ENSG00000148584 |
---|---|
2nd row | ENSG00000148584 |
3rd row | ENSG00000148584 |
4th row | ENSG00000148584 |
5th row | ENSG00000148584 |
Common Values
Value | Count | Frequency (%) |
ENSG00000172014 | 36 | 0.2% |
ENSG00000276203 | 34 | 0.2% |
ENSG00000185894 | 30 | 0.1% |
ENSG00000174876 | 30 | 0.1% |
ENSG00000237763 | 30 | 0.1% |
ENSG00000187733 | 30 | 0.1% |
ENSG00000183795 | 30 | 0.1% |
ENSG00000183753 | 30 | 0.1% |
ENSG00000183148 | 29 | 0.1% |
ENSG00000187134 | 25 | 0.1% |
Other values (2073) | 19696 |
Length
Value | Count | Frequency (%) |
ensg00000172014 | 36 | 0.2% |
ensg00000276203 | 34 | 0.2% |
ensg00000185894 | 30 | 0.1% |
ensg00000237763 | 30 | 0.1% |
ensg00000187733 | 30 | 0.1% |
ensg00000183795 | 30 | 0.1% |
ensg00000183753 | 30 | 0.1% |
ensg00000174876 | 30 | 0.1% |
ensg00000183148 | 29 | 0.1% |
ensg00000187134 | 25 | 0.1% |
Other values (2073) | 19696 |
Most occurring characters
Value | Count | Frequency (%) |
0 | 112027 | |
1 | 24286 | 8.1% |
E | 20000 | 6.7% |
N | 20000 | 6.7% |
S | 20000 | 6.7% |
G | 20000 | 6.7% |
2 | 12286 | 4.1% |
6 | 11286 | 3.8% |
7 | 11211 | 3.7% |
3 | 10807 | 3.6% |
Other values (4) | 38097 | 12.7% |
Most occurring categories
Value | Count | Frequency (%) |
Decimal Number | 220000 | |
Uppercase Letter | 80000 | 26.7% |
Most frequent character per category
Decimal Number
Value | Count | Frequency (%) |
0 | 112027 | |
1 | 24286 | 11.0% |
2 | 12286 | 5.6% |
6 | 11286 | 5.1% |
7 | 11211 | 5.1% |
3 | 10807 | 4.9% |
8 | 10196 | 4.6% |
4 | 10049 | 4.6% |
5 | 9399 | 4.3% |
9 | 8453 | 3.8% |
Uppercase Letter
Value | Count | Frequency (%) |
E | 20000 | |
N | 20000 | |
S | 20000 | |
G | 20000 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 220000 | |
Latin | 80000 | 26.7% |
Most frequent character per script
Common
Value | Count | Frequency (%) |
0 | 112027 | |
1 | 24286 | 11.0% |
2 | 12286 | 5.6% |
6 | 11286 | 5.1% |
7 | 11211 | 5.1% |
3 | 10807 | 4.9% |
8 | 10196 | 4.6% |
4 | 10049 | 4.6% |
5 | 9399 | 4.3% |
9 | 8453 | 3.8% |
Latin
Value | Count | Frequency (%) |
E | 20000 | |
N | 20000 | |
S | 20000 | |
G | 20000 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 300000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
0 | 112027 | |
1 | 24286 | 8.1% |
E | 20000 | 6.7% |
N | 20000 | 6.7% |
S | 20000 | 6.7% |
G | 20000 | 6.7% |
2 | 12286 | 4.1% |
6 | 11286 | 3.8% |
7 | 11211 | 3.7% |
3 | 10807 | 3.6% |
Other values (4) | 38097 | 12.7% |
Distinct | 1956 |
---|---|
Distinct (%) | 9.8% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
APOM | 70 |
---|---|
ATP6V1G2 | 70 |
BAG6 | 70 |
ATAT1 | 70 |
ABCF1 | 70 |
Other values (1951) |
Length
Max length | 15 |
---|---|
Median length | 13 |
Mean length | 5.76775 |
Min length | 2 |
Characters and Unicode
Total characters | 115355 |
---|---|
Distinct characters | 40 |
Distinct categories | 4 ? |
Distinct scripts | 2 ? |
Distinct blocks | 1 ? |
Unique
Unique | 34 ? |
---|---|
Unique (%) | 0.2% |
Sample
1st row | A1CF |
---|---|
2nd row | A1CF |
3rd row | A1CF |
4th row | A1CF |
5th row | A1CF |
Common Values
Value | Count | Frequency (%) |
APOM | 70 | 0.4% |
ATP6V1G2 | 70 | 0.4% |
BAG6 | 70 | 0.4% |
ATAT1 | 70 | 0.4% |
ABCF1 | 70 | 0.4% |
AGER | 68 | 0.3% |
AGPAT1 | 63 | 0.3% |
BRD2 | 63 | 0.3% |
AIF1 | 60 | 0.3% |
ARL17B | 57 | 0.3% |
Other values (1946) | 19339 |
Length
Value | Count | Frequency (%) |
apom | 70 | 0.4% |
atat1 | 70 | 0.4% |
abcf1 | 70 | 0.4% |
atp6v1g2 | 70 | 0.4% |
bag6 | 70 | 0.4% |
ager | 68 | 0.3% |
agpat1 | 63 | 0.3% |
brd2 | 63 | 0.3% |
aif1 | 60 | 0.3% |
arl17b | 57 | 0.3% |
Other values (1946) | 19339 |
Most occurring characters
Value | Count | Frequency (%) |
A | 18588 | |
1 | 10743 | 9.3% |
C | 7459 | 6.5% |
B | 6795 | 5.9% |
2 | 5593 | 4.8% |
P | 5158 | 4.5% |
R | 4662 | 4.0% |
T | 4253 | 3.7% |
D | 3932 | 3.4% |
L | 3524 | 3.1% |
Other values (30) | 44648 |
Most occurring categories
Value | Count | Frequency (%) |
Uppercase Letter | 75977 | |
Decimal Number | 31032 | |
Lowercase Letter | 8247 | 7.1% |
Dash Punctuation | 99 | 0.1% |
Most frequent character per category
Uppercase Letter
Value | Count | Frequency (%) |
A | 18588 | |
C | 7459 | |
B | 6795 | 8.9% |
P | 5158 | 6.8% |
R | 4662 | 6.1% |
T | 4253 | 5.6% |
D | 3932 | 5.2% |
L | 3524 | 4.6% |
G | 2765 | 3.6% |
N | 2611 | 3.4% |
Other values (16) | 16230 |
Decimal Number
Value | Count | Frequency (%) |
1 | 10743 | |
2 | 5593 | |
3 | 3084 | 9.9% |
4 | 2259 | 7.3% |
5 | 1976 | 6.4% |
6 | 1873 | 6.0% |
7 | 1654 | 5.3% |
0 | 1412 | 4.6% |
9 | 1331 | 4.3% |
8 | 1107 | 3.6% |
Lowercase Letter
Value | Count | Frequency (%) |
o | 2749 | |
f | 2749 | |
r | 2749 |
Dash Punctuation
Value | Count | Frequency (%) |
- | 99 |
Most occurring scripts
Value | Count | Frequency (%) |
Latin | 84224 | |
Common | 31131 | 27.0% |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
A | 18588 | |
C | 7459 | 8.9% |
B | 6795 | 8.1% |
P | 5158 | 6.1% |
R | 4662 | 5.5% |
T | 4253 | 5.0% |
D | 3932 | 4.7% |
L | 3524 | 4.2% |
G | 2765 | 3.3% |
o | 2749 | 3.3% |
Other values (19) | 24339 |
Common
Value | Count | Frequency (%) |
1 | 10743 | |
2 | 5593 | |
3 | 3084 | 9.9% |
4 | 2259 | 7.3% |
5 | 1976 | 6.3% |
6 | 1873 | 6.0% |
7 | 1654 | 5.3% |
0 | 1412 | 4.5% |
9 | 1331 | 4.3% |
8 | 1107 | 3.6% |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 115355 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
A | 18588 | |
1 | 10743 | 9.3% |
C | 7459 | 6.5% |
B | 6795 | 5.9% |
2 | 5593 | 4.8% |
P | 5158 | 4.5% |
R | 4662 | 4.0% |
T | 4253 | 3.7% |
D | 3932 | 3.4% |
L | 3524 | 3.1% |
Other values (30) | 44648 |
Distinct | 18349 |
---|---|
Distinct (%) | 91.7% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
GGAGAGTGACCACTTGCACATGG | 16 |
---|---|
ATAGTCAATGGACAAGGAGAAGG | 16 |
GTGCTTCAATATGTGCACCATGG | 16 |
TCATGCGAAGATCCAGGTAAAGG | 16 |
TGAGGTGCTCTCACTATACACGG | 16 |
Other values (18344) |
Length
Max length | 23 |
---|---|
Median length | 23 |
Mean length | 23 |
Min length | 23 |
Characters and Unicode
Total characters | 460000 |
---|---|
Distinct characters | 4 |
Distinct categories | 1 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 17645 ? |
---|---|
Unique (%) | 88.2% |
Sample
1st row | GCAGCATCCCAACCAGGTGGAGG |
---|---|
2nd row | GCGGGAGTGAGAGGACTGGGCGG |
3rd row | ATGACTCTCATACTCCACGAAGG |
4th row | GAGTCATCGAGCAGCTGCCATGG |
5th row | AGTCACCCTAGCAAAACCAGTGG |
Common Values
Value | Count | Frequency (%) |
GGAGAGTGACCACTTGCACATGG | 16 | 0.1% |
ATAGTCAATGGACAAGGAGAAGG | 16 | 0.1% |
GTGCTTCAATATGTGCACCATGG | 16 | 0.1% |
TCATGCGAAGATCCAGGTAAAGG | 16 | 0.1% |
TGAGGTGCTCTCACTATACACGG | 16 | 0.1% |
GAGCGATATTTAGCTCCCAAGGG | 12 | 0.1% |
AGCCAGGACACGTGCAGGACAGG | 9 | < 0.1% |
TTCTAGGTAATTGATCTGGGTGG | 9 | < 0.1% |
TGTGGTAATGCTGTGAGTGCAGG | 9 | < 0.1% |
GTTGGGCCACCAAATGATAATGG | 9 | < 0.1% |
Other values (18339) | 19872 |
Length
Value | Count | Frequency (%) |
ggagagtgaccacttgcacatgg | 16 | 0.1% |
gtgcttcaatatgtgcaccatgg | 16 | 0.1% |
tcatgcgaagatccaggtaaagg | 16 | 0.1% |
tgaggtgctctcactatacacgg | 16 | 0.1% |
atagtcaatggacaaggagaagg | 16 | 0.1% |
gagcgatatttagctcccaaggg | 12 | 0.1% |
tacctgtgaaaatctggggcagg | 9 | < 0.1% |
gactagatgcaacaatgttgggg | 9 | < 0.1% |
catacctttggactgaagcaagg | 9 | < 0.1% |
tggtcttctcgatcttgcactgg | 9 | < 0.1% |
Other values (18339) | 19872 |
Most occurring characters
Value | Count | Frequency (%) |
G | 172114 | |
A | 112466 | |
C | 102550 | |
T | 72870 |
Most occurring categories
Value | Count | Frequency (%) |
Uppercase Letter | 460000 |
Most frequent character per category
Uppercase Letter
Value | Count | Frequency (%) |
G | 172114 | |
A | 112466 | |
C | 102550 | |
T | 72870 |
Most occurring scripts
Value | Count | Frequency (%) |
Latin | 460000 |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
G | 172114 | |
A | 112466 | |
C | 102550 | |
T | 72870 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 460000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
G | 172114 | |
A | 112466 | |
C | 102550 | |
T | 72870 |
Distinct | 2 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
+ | |
---|---|
- |
Length
Max length | 1 |
---|---|
Median length | 1 |
Mean length | 1 |
Min length | 1 |
Characters and Unicode
Total characters | 20000 |
---|---|
Distinct characters | 2 |
Distinct categories | 2 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 0 ? |
---|---|
Unique (%) | 0.0% |
Sample
1st row | + |
---|---|
2nd row | - |
3rd row | + |
4th row | - |
5th row | - |
Common Values
Value | Count | Frequency (%) |
+ | 10079 | |
- | 9921 |
Length
Category Frequency Plot
Value | Count | Frequency (%) |
20000 |
Most occurring characters
Value | Count | Frequency (%) |
+ | 10079 | |
- | 9921 |
Most occurring categories
Value | Count | Frequency (%) |
Math Symbol | 10079 | |
Dash Punctuation | 9921 |
Most frequent character per category
Math Symbol
Value | Count | Frequency (%) |
+ | 10079 |
Dash Punctuation
Value | Count | Frequency (%) |
- | 9921 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 20000 |
Most frequent character per script
Common
Value | Count | Frequency (%) |
+ | 10079 | |
- | 9921 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 20000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
+ | 10079 | |
- | 9921 |
Distinct | 1 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
26472758 |
---|
Length
Max length | 8 |
---|---|
Median length | 8 |
Mean length | 8 |
Min length | 8 |
Characters and Unicode
Total characters | 160000 |
---|---|
Distinct characters | 6 |
Distinct categories | 1 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 0 ? |
---|---|
Unique (%) | 0.0% |
Sample
1st row | 26472758 |
---|---|
2nd row | 26472758 |
3rd row | 26472758 |
4th row | 26472758 |
5th row | 26472758 |
Common Values
Value | Count | Frequency (%) |
26472758 | 20000 |
Length
Category Frequency Plot
Value | Count | Frequency (%) |
26472758 | 20000 |
Most occurring characters
Value | Count | Frequency (%) |
2 | 40000 | |
7 | 40000 | |
6 | 20000 | |
4 | 20000 | |
5 | 20000 | |
8 | 20000 |
Most occurring categories
Value | Count | Frequency (%) |
Decimal Number | 160000 |
Most frequent character per category
Decimal Number
Value | Count | Frequency (%) |
2 | 40000 | |
7 | 40000 | |
6 | 20000 | |
4 | 20000 | |
5 | 20000 | |
8 | 20000 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 160000 |
Most frequent character per script
Common
Value | Count | Frequency (%) |
2 | 40000 | |
7 | 40000 | |
6 | 20000 | |
4 | 20000 | |
5 | 20000 | |
8 | 20000 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 160000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
2 | 40000 | |
7 | 40000 | |
6 | 20000 | |
4 | 20000 | |
5 | 20000 | |
8 | 20000 |
Distinct | 1 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
hSpCas9 |
---|
Length
Max length | 7 |
---|---|
Median length | 7 |
Mean length | 7 |
Min length | 7 |
Characters and Unicode
Total characters | 140000 |
---|---|
Distinct characters | 7 |
Distinct categories | 3 ? |
Distinct scripts | 2 ? |
Distinct blocks | 1 ? |
Unique
Unique | 0 ? |
---|---|
Unique (%) | 0.0% |
Sample
1st row | hSpCas9 |
---|---|
2nd row | hSpCas9 |
3rd row | hSpCas9 |
4th row | hSpCas9 |
5th row | hSpCas9 |
Common Values
Value | Count | Frequency (%) |
hSpCas9 | 20000 |
Length
Category Frequency Plot
Value | Count | Frequency (%) |
hspcas9 | 20000 |
Most occurring characters
Value | Count | Frequency (%) |
h | 20000 | |
S | 20000 | |
p | 20000 | |
C | 20000 | |
a | 20000 | |
s | 20000 | |
9 | 20000 |
Most occurring categories
Value | Count | Frequency (%) |
Lowercase Letter | 80000 | |
Uppercase Letter | 40000 | |
Decimal Number | 20000 | 14.3% |
Most frequent character per category
Lowercase Letter
Value | Count | Frequency (%) |
h | 20000 | |
p | 20000 | |
a | 20000 | |
s | 20000 |
Uppercase Letter
Value | Count | Frequency (%) |
S | 20000 | |
C | 20000 |
Decimal Number
Value | Count | Frequency (%) |
9 | 20000 |
Most occurring scripts
Value | Count | Frequency (%) |
Latin | 120000 | |
Common | 20000 | 14.3% |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
h | 20000 | |
S | 20000 | |
p | 20000 | |
C | 20000 | |
a | 20000 | |
s | 20000 |
Common
Value | Count | Frequency (%) |
9 | 20000 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 140000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
h | 20000 | |
S | 20000 | |
p | 20000 | |
C | 20000 | |
a | 20000 | |
s | 20000 | |
9 | 20000 |
Distinct | 1 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
negative selection |
---|
Length
Max length | 18 |
---|---|
Median length | 18 |
Mean length | 18 |
Min length | 18 |
Characters and Unicode
Total characters | 360000 |
---|---|
Distinct characters | 12 |
Distinct categories | 2 ? |
Distinct scripts | 2 ? |
Distinct blocks | 1 ? |
Unique
Unique | 0 ? |
---|---|
Unique (%) | 0.0% |
Sample
1st row | negative selection |
---|---|
2nd row | negative selection |
3rd row | negative selection |
4th row | negative selection |
5th row | negative selection |
Common Values
Value | Count | Frequency (%) |
negative selection | 20000 |
Length
Category Frequency Plot
Value | Count | Frequency (%) |
negative | 20000 | |
selection | 20000 |
Most occurring characters
Value | Count | Frequency (%) |
e | 80000 | |
n | 40000 | |
t | 40000 | |
i | 40000 | |
g | 20000 | 5.6% |
a | 20000 | 5.6% |
v | 20000 | 5.6% |
20000 | 5.6% | |
s | 20000 | 5.6% |
l | 20000 | 5.6% |
Other values (2) | 40000 |
Most occurring categories
Value | Count | Frequency (%) |
Lowercase Letter | 340000 | |
Space Separator | 20000 | 5.6% |
Most frequent character per category
Lowercase Letter
Value | Count | Frequency (%) |
e | 80000 | |
n | 40000 | |
t | 40000 | |
i | 40000 | |
g | 20000 | 5.9% |
a | 20000 | 5.9% |
v | 20000 | 5.9% |
s | 20000 | 5.9% |
l | 20000 | 5.9% |
c | 20000 | 5.9% |
Space Separator
Value | Count | Frequency (%) |
20000 |
Most occurring scripts
Value | Count | Frequency (%) |
Latin | 340000 | |
Common | 20000 | 5.6% |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
e | 80000 | |
n | 40000 | |
t | 40000 | |
i | 40000 | |
g | 20000 | 5.9% |
a | 20000 | 5.9% |
v | 20000 | 5.9% |
s | 20000 | 5.9% |
l | 20000 | 5.9% |
c | 20000 | 5.9% |
Common
Value | Count | Frequency (%) |
20000 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 360000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
e | 80000 | |
n | 40000 | |
t | 40000 | |
i | 40000 | |
g | 20000 | 5.6% |
a | 20000 | 5.6% |
v | 20000 | 5.6% |
20000 | 5.6% | |
s | 20000 | 5.6% |
l | 20000 | 5.6% |
Other values (2) | 40000 |
Distinct | 1 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
Jiyoye |
---|
Length
Max length | 6 |
---|---|
Median length | 6 |
Mean length | 6 |
Min length | 6 |
Characters and Unicode
Total characters | 120000 |
---|---|
Distinct characters | 5 |
Distinct categories | 2 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 0 ? |
---|---|
Unique (%) | 0.0% |
Sample
1st row | Jiyoye |
---|---|
2nd row | Jiyoye |
3rd row | Jiyoye |
4th row | Jiyoye |
5th row | Jiyoye |
Common Values
Value | Count | Frequency (%) |
Jiyoye | 20000 |
Length
Category Frequency Plot
Value | Count | Frequency (%) |
jiyoye | 20000 |
Most occurring characters
Value | Count | Frequency (%) |
y | 40000 | |
J | 20000 | |
i | 20000 | |
o | 20000 | |
e | 20000 |
Most occurring categories
Value | Count | Frequency (%) |
Lowercase Letter | 100000 | |
Uppercase Letter | 20000 | 16.7% |
Most frequent character per category
Lowercase Letter
Value | Count | Frequency (%) |
y | 40000 | |
i | 20000 | |
o | 20000 | |
e | 20000 |
Uppercase Letter
Value | Count | Frequency (%) |
J | 20000 |
Most occurring scripts
Value | Count | Frequency (%) |
Latin | 120000 |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
y | 40000 | |
J | 20000 | |
i | 20000 | |
o | 20000 | |
e | 20000 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 120000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
y | 40000 | |
J | 20000 | |
i | 20000 | |
o | 20000 | |
e | 20000 |
Distinct | 1378 |
---|---|
Distinct (%) | 6.9% |
Missing | 0 |
Missing (%) | 0.0% |
Infinite | 0 |
Infinite (%) | 0.0% |
Mean | 0.6260735334 |
Minimum | 1.248735335 × 10-5 |
---|---|
Maximum | 0.9999813664 |
Zeros | 0 |
Zeros (%) | 0.0% |
Negative | 0 |
Negative (%) | 0.0% |
Memory size | 156.4 KiB |
Quantile statistics
Minimum | 1.248735335 × 10-5 |
---|---|
5-th percentile | 0.0117820868 |
Q1 | 0.4176767223 |
median | 0.7141961313 |
Q3 | 0.8857393361 |
95-th percentile | 0.9832672947 |
Maximum | 0.9999813664 |
Range | 0.999968879 |
Interquartile range (IQR) | 0.4680626138 |
Descriptive statistics
Standard deviation | 0.3051406301 |
---|---|
Coefficient of variation (CV) | 0.4873878447 |
Kurtosis | -0.7156432969 |
Mean | 0.6260735334 |
Median Absolute Deviation (MAD) | 0.2061126918 |
Skewness | -0.6982329418 |
Sum | 12521.47067 |
Variance | 0.09311080414 |
Monotonicity | Not monotonic |
Value | Count | Frequency (%) |
0.897696761 | 126 | 0.6% |
0.5215339035 | 100 | 0.5% |
0.9726951334 | 92 | 0.5% |
0.03309504096 | 90 | 0.4% |
0.9909719195 | 81 | 0.4% |
0.4262849916 | 81 | 0.4% |
0.8766792768 | 80 | 0.4% |
0.9228333843 | 80 | 0.4% |
0.2221949719 | 79 | 0.4% |
0.9912707955 | 78 | 0.4% |
Other values (1368) | 19113 |
Value | Count | Frequency (%) |
1.248735335 × 10-5 | 10 | |
1.656722788 × 10-5 | 19 | |
2.533789228 × 10-5 | 10 | |
2.752990342 × 10-5 | 10 | |
2.763798739 × 10-5 | 10 | |
2.959303515 × 10-5 | 10 | |
3.073828034 × 10-5 | 10 | |
3.605121453 × 10-5 | 10 | |
3.853987714 × 10-5 | 1 | < 0.1% |
4.495479604 × 10-5 | 10 |
Value | Count | Frequency (%) |
0.9999813664 | 65 | |
0.9998111765 | 10 | 0.1% |
0.9997012286 | 6 | < 0.1% |
0.9989142831 | 2 | < 0.1% |
0.9987868647 | 70 | |
0.9986261462 | 10 | 0.1% |
0.9984412016 | 50 | |
0.9982535696 | 10 | 0.1% |
0.998175766 | 20 | 0.1% |
0.9980702928 | 10 | 0.1% |
Distinct | 2 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 19.7 KiB |
False | |
---|---|
True | 1605 |
Value | Count | Frequency (%) |
False | 18395 | |
True | 1605 | 8.0% |
Distinct | 1 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
viability |
---|
Length
Max length | 9 |
---|---|
Median length | 9 |
Mean length | 9 |
Min length | 9 |
Characters and Unicode
Total characters | 180000 |
---|---|
Distinct characters | 7 |
Distinct categories | 1 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 0 ? |
---|---|
Unique (%) | 0.0% |
Sample
1st row | viability |
---|---|
2nd row | viability |
3rd row | viability |
4th row | viability |
5th row | viability |
Common Values
Value | Count | Frequency (%) |
viability | 20000 |
Length
Category Frequency Plot
Value | Count | Frequency (%) |
viability | 20000 |
Most occurring characters
Value | Count | Frequency (%) |
i | 60000 | |
v | 20000 | 11.1% |
a | 20000 | 11.1% |
b | 20000 | 11.1% |
l | 20000 | 11.1% |
t | 20000 | 11.1% |
y | 20000 | 11.1% |
Most occurring categories
Value | Count | Frequency (%) |
Lowercase Letter | 180000 |
Most frequent character per category
Lowercase Letter
Value | Count | Frequency (%) |
i | 60000 | |
v | 20000 | 11.1% |
a | 20000 | 11.1% |
b | 20000 | 11.1% |
l | 20000 | 11.1% |
t | 20000 | 11.1% |
y | 20000 | 11.1% |
Most occurring scripts
Value | Count | Frequency (%) |
Latin | 180000 |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
i | 60000 | |
v | 20000 | 11.1% |
a | 20000 | 11.1% |
b | 20000 | 11.1% |
l | 20000 | 11.1% |
t | 20000 | 11.1% |
y | 20000 | 11.1% |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 180000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
i | 60000 | |
v | 20000 | 11.1% |
a | 20000 | 11.1% |
b | 20000 | 11.1% |
l | 20000 | 11.1% |
t | 20000 | 11.1% |
y | 20000 | 11.1% |
Distinct | 2083 |
---|---|
Distinct (%) | 10.4% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
ANKRD20A4::ENSG00000172014 | 36 |
---|---|
ANKRD20A3::ENSG00000276203 | 34 |
BPY2C::ENSG00000185894 | 30 |
AMY1B::ENSG00000174876 | 30 |
AMY1A::ENSG00000237763 | 30 |
Other values (2078) |
Length
Max length | 32 |
---|---|
Median length | 30 |
Mean length | 22.76775 |
Min length | 19 |
Characters and Unicode
Total characters | 455355 |
---|---|
Distinct characters | 41 |
Distinct categories | 5 ? |
Distinct scripts | 2 ? |
Distinct blocks | 1 ? |
Unique
Unique | 38 ? |
---|---|
Unique (%) | 0.2% |
Sample
1st row | A1CF::ENSG00000148584 |
---|---|
2nd row | A1CF::ENSG00000148584 |
3rd row | A1CF::ENSG00000148584 |
4th row | A1CF::ENSG00000148584 |
5th row | A1CF::ENSG00000148584 |
Common Values
Value | Count | Frequency (%) |
ANKRD20A4::ENSG00000172014 | 36 | 0.2% |
ANKRD20A3::ENSG00000276203 | 34 | 0.2% |
BPY2C::ENSG00000185894 | 30 | 0.1% |
AMY1B::ENSG00000174876 | 30 | 0.1% |
AMY1A::ENSG00000237763 | 30 | 0.1% |
AMY1C::ENSG00000187733 | 30 | 0.1% |
BPY2B::ENSG00000183795 | 30 | 0.1% |
BPY2::ENSG00000183753 | 30 | 0.1% |
ANKRD20A2::ENSG00000183148 | 29 | 0.1% |
AKR1C1::ENSG00000187134 | 25 | 0.1% |
Other values (2073) | 19696 |
Length
Value | Count | Frequency (%) |
ankrd20a4::ensg00000172014 | 36 | 0.2% |
ankrd20a3::ensg00000276203 | 34 | 0.2% |
bpy2c::ensg00000185894 | 30 | 0.1% |
amy1a::ensg00000237763 | 30 | 0.1% |
amy1c::ensg00000187733 | 30 | 0.1% |
bpy2b::ensg00000183795 | 30 | 0.1% |
bpy2::ensg00000183753 | 30 | 0.1% |
amy1b::ensg00000174876 | 30 | 0.1% |
ankrd20a2::ensg00000183148 | 29 | 0.1% |
akr1c1::ensg00000187134 | 25 | 0.1% |
Other values (2073) | 19696 |
Most occurring characters
Value | Count | Frequency (%) |
0 | 113439 | |
: | 40000 | 8.8% |
1 | 35029 | 7.7% |
G | 22765 | 5.0% |
N | 22611 | 5.0% |
S | 22243 | 4.9% |
E | 21290 | 4.7% |
A | 18588 | 4.1% |
2 | 17879 | 3.9% |
3 | 13891 | 3.1% |
Other values (31) | 127620 |
Most occurring categories
Value | Count | Frequency (%) |
Decimal Number | 251032 | |
Uppercase Letter | 155977 | |
Other Punctuation | 40000 | 8.8% |
Lowercase Letter | 8247 | 1.8% |
Dash Punctuation | 99 | < 0.1% |
Most frequent character per category
Uppercase Letter
Value | Count | Frequency (%) |
G | 22765 | |
N | 22611 | |
S | 22243 | |
E | 21290 | |
A | 18588 | |
C | 7459 | 4.8% |
B | 6795 | 4.4% |
P | 5158 | 3.3% |
R | 4662 | 3.0% |
T | 4253 | 2.7% |
Other values (16) | 20153 |
Decimal Number
Value | Count | Frequency (%) |
0 | 113439 | |
1 | 35029 | 14.0% |
2 | 17879 | 7.1% |
3 | 13891 | 5.5% |
6 | 13159 | 5.2% |
7 | 12865 | 5.1% |
4 | 12308 | 4.9% |
5 | 11375 | 4.5% |
8 | 11303 | 4.5% |
9 | 9784 | 3.9% |
Lowercase Letter
Value | Count | Frequency (%) |
o | 2749 | |
r | 2749 | |
f | 2749 |
Other Punctuation
Value | Count | Frequency (%) |
: | 40000 |
Dash Punctuation
Value | Count | Frequency (%) |
- | 99 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 291131 | |
Latin | 164224 |
Most frequent character per script
Latin
Value | Count | Frequency (%) |
G | 22765 | |
N | 22611 | |
S | 22243 | |
E | 21290 | |
A | 18588 | |
C | 7459 | 4.5% |
B | 6795 | 4.1% |
P | 5158 | 3.1% |
R | 4662 | 2.8% |
T | 4253 | 2.6% |
Other values (19) | 28400 |
Common
Value | Count | Frequency (%) |
0 | 113439 | |
: | 40000 | 13.7% |
1 | 35029 | 12.0% |
2 | 17879 | 6.1% |
3 | 13891 | 4.8% |
6 | 13159 | 4.5% |
7 | 12865 | 4.4% |
4 | 12308 | 4.2% |
5 | 11375 | 3.9% |
8 | 11303 | 3.9% |
Other values (2) | 9883 | 3.4% |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 455355 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
0 | 113439 | |
: | 40000 | 8.8% |
1 | 35029 | 7.7% |
G | 22765 | 5.0% |
N | 22611 | 5.0% |
S | 22243 | 4.9% |
E | 21290 | 4.7% |
A | 18588 | 4.1% |
2 | 17879 | 3.9% |
3 | 13891 | 3.1% |
Other values (31) | 127620 |
Distinct | 1 |
---|---|
Distinct (%) | < 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
---|
Length
Max length | 584 |
---|---|
Median length | 584 |
Mean length | 584 |
Min length | 584 |
Characters and Unicode
Total characters | 11680000 |
---|---|
Distinct characters | 15 |
Distinct categories | 5 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 0 ? |
---|---|
Unique (%) | 0.0% |
Sample
1st row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
---|---|
2nd row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
3rd row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
4th row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
5th row | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] |
Common Values
Value | Count | Frequency (%) |
[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 20000 |
Length
Category Frequency Plot
Value | Count | Frequency (%) |
0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07 | 20000 |
Most occurring characters
Value | Count | Frequency (%) |
, | 1980000 | |
. | 1920000 | |
0 | 1800000 | |
[ | 1020000 | |
] | 1020000 | |
1 | 840000 | |
4 | 540000 | 4.6% |
5 | 440000 | 3.8% |
2 | 440000 | 3.8% |
3 | 380000 | 3.3% |
Other values (5) | 1300000 |
Most occurring categories
Value | Count | Frequency (%) |
Decimal Number | 5700000 | |
Other Punctuation | 3900000 | |
Open Punctuation | 1020000 | 8.7% |
Close Punctuation | 1020000 | 8.7% |
Dash Punctuation | 40000 | 0.3% |
Most frequent character per category
Decimal Number
Value | Count | Frequency (%) |
0 | 1800000 | |
1 | 840000 | |
4 | 540000 | 9.5% |
5 | 440000 | 7.7% |
2 | 440000 | 7.7% |
3 | 380000 | 6.7% |
6 | 340000 | 6.0% |
8 | 340000 | 6.0% |
9 | 300000 | 5.3% |
7 | 280000 | 4.9% |
Other Punctuation
Value | Count | Frequency (%) |
, | 1980000 | |
. | 1920000 |
Open Punctuation
Value | Count | Frequency (%) |
[ | 1020000 |
Close Punctuation
Value | Count | Frequency (%) |
] | 1020000 |
Dash Punctuation
Value | Count | Frequency (%) |
- | 40000 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 11680000 |
Most frequent character per script
Common
Value | Count | Frequency (%) |
, | 1980000 | |
. | 1920000 | |
0 | 1800000 | |
[ | 1020000 | |
] | 1020000 | |
1 | 840000 | |
4 | 540000 | 4.6% |
5 | 440000 | 3.8% |
2 | 440000 | 3.8% |
3 | 380000 | 3.3% |
Other values (5) | 1300000 |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 11680000 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
, | 1980000 | |
. | 1920000 | |
0 | 1800000 | |
[ | 1020000 | |
] | 1020000 | |
1 | 840000 | |
4 | 540000 | 4.6% |
5 | 440000 | 3.8% |
2 | 440000 | 3.8% |
3 | 380000 | 3.3% |
Other values (5) | 1300000 |
Distinct | 19 |
---|---|
Distinct (%) | 0.1% |
Missing | 0 |
Missing (%) | 0.0% |
Infinite | 0 |
Infinite (%) | 0.0% |
Mean | 0.62725 |
Minimum | -9 |
---|---|
Maximum | 9 |
Zeros | 2043 |
Zeros (%) | 10.2% |
Negative | 7930 |
Negative (%) | 39.6% |
Memory size | 156.4 KiB |
Quantile statistics
Minimum | -9 |
---|---|
5-th percentile | -8 |
Q1 | -4 |
median | 1 |
Q3 | 5 |
95-th percentile | 9 |
Maximum | 9 |
Range | 18 |
Interquartile range (IQR) | 9 |
Descriptive statistics
Standard deviation | 5.200486486 |
---|---|
Coefficient of variation (CV) | 8.290931026 |
Kurtosis | -1.059658099 |
Mean | 0.62725 |
Median Absolute Deviation (MAD) | 4 |
Skewness | -0.1165224787 |
Sum | 12545 |
Variance | 27.04505969 |
Monotonicity | Not monotonic |
Value | Count | Frequency (%) |
0 | 2043 | 10.2% |
7 | 1142 | 5.7% |
5 | 1135 | 5.7% |
9 | 1135 | 5.7% |
4 | 1117 | 5.6% |
3 | 1114 | 5.6% |
8 | 1108 | 5.5% |
2 | 1102 | 5.5% |
1 | 1100 | 5.5% |
6 | 1074 | 5.4% |
Other values (9) | 7930 |
Value | Count | Frequency (%) |
-9 | 665 | 3.3% |
-8 | 721 | 3.6% |
-7 | 893 | |
-6 | 973 | |
-5 | 902 | |
-4 | 925 | |
-3 | 962 | |
-2 | 934 | |
-1 | 955 | |
0 | 2043 |
Value | Count | Frequency (%) |
9 | 1135 | |
8 | 1108 | |
7 | 1142 | |
6 | 1074 | |
5 | 1135 | |
4 | 1117 | |
3 | 1114 | |
2 | 1102 | |
1 | 1100 | |
0 | 2043 |
Distinct | 643 |
---|---|
Distinct (%) | 3.2% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
[0] | 745 |
---|---|
[77] | 126 |
[65] | 111 |
[61] | 110 |
[120] | 104 |
Other values (638) |
Length
Max length | 6 |
---|---|
Median length | 5 |
Mean length | 4.5367 |
Min length | 3 |
Characters and Unicode
Total characters | 90734 |
---|---|
Distinct characters | 12 |
Distinct categories | 3 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 97 ? |
---|---|
Unique (%) | 0.5% |
Sample
1st row | [260] |
---|---|
2nd row | [17] |
3rd row | [75] |
4th row | [47] |
5th row | [58] |
Common Values
Value | Count | Frequency (%) |
[0] | 745 | 3.7% |
[77] | 126 | 0.6% |
[65] | 111 | 0.6% |
[61] | 110 | 0.5% |
[120] | 104 | 0.5% |
[74] | 103 | 0.5% |
[102] | 102 | 0.5% |
[38] | 101 | 0.5% |
[69] | 100 | 0.5% |
[97] | 100 | 0.5% |
Other values (633) | 18298 |
Length
Value | Count | Frequency (%) |
0 | 745 | 3.7% |
77 | 126 | 0.6% |
65 | 111 | 0.6% |
61 | 110 | 0.5% |
120 | 104 | 0.5% |
74 | 103 | 0.5% |
102 | 102 | 0.5% |
38 | 101 | 0.5% |
69 | 100 | 0.5% |
97 | 100 | 0.5% |
Other values (633) | 18298 |
Most occurring characters
Value | Count | Frequency (%) |
[ | 20000 | |
] | 20000 | |
1 | 10739 | |
2 | 7330 | 8.1% |
3 | 5127 | 5.7% |
0 | 4306 | 4.7% |
4 | 4290 | 4.7% |
5 | 4131 | 4.6% |
7 | 3871 | 4.3% |
6 | 3825 | 4.2% |
Other values (2) | 7115 | 7.8% |
Most occurring categories
Value | Count | Frequency (%) |
Decimal Number | 50734 | |
Open Punctuation | 20000 | 22.0% |
Close Punctuation | 20000 | 22.0% |
Most frequent character per category
Decimal Number
Value | Count | Frequency (%) |
1 | 10739 | |
2 | 7330 | |
3 | 5127 | |
0 | 4306 | |
4 | 4290 | 8.5% |
5 | 4131 | 8.1% |
7 | 3871 | 7.6% |
6 | 3825 | 7.5% |
8 | 3595 | 7.1% |
9 | 3520 | 6.9% |
Open Punctuation
Value | Count | Frequency (%) |
[ | 20000 |
Close Punctuation
Value | Count | Frequency (%) |
] | 20000 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 90734 |
Most frequent character per script
Common
Value | Count | Frequency (%) |
[ | 20000 | |
] | 20000 | |
1 | 10739 | |
2 | 7330 | 8.1% |
3 | 5127 | 5.7% |
0 | 4306 | 4.7% |
4 | 4290 | 4.7% |
5 | 4131 | 4.6% |
7 | 3871 | 4.3% |
6 | 3825 | 4.2% |
Other values (2) | 7115 | 7.8% |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 90734 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
[ | 20000 | |
] | 20000 | |
1 | 10739 | |
2 | 7330 | 8.1% |
3 | 5127 | 5.7% |
0 | 4306 | 4.7% |
4 | 4290 | 4.7% |
5 | 4131 | 4.6% |
7 | 3871 | 4.3% |
6 | 3825 | 4.2% |
Other values (2) | 7115 | 7.8% |
Distinct | 548 |
---|---|
Distinct (%) | 2.7% |
Missing | 0 |
Missing (%) | 0.0% |
Memory size | 156.4 KiB |
[0] | 253 |
---|---|
[75] | 141 |
[35] | 136 |
[25] | 132 |
[36] | 130 |
Other values (543) |
Length
Max length | 6 |
---|---|
Median length | 5 |
Mean length | 4.42495 |
Min length | 3 |
Characters and Unicode
Total characters | 88499 |
---|---|
Distinct characters | 12 |
Distinct categories | 3 ? |
Distinct scripts | 1 ? |
Distinct blocks | 1 ? |
Unique
Unique | 84 ? |
---|---|
Unique (%) | 0.4% |
Sample
1st row | [244] |
---|---|
2nd row | [59] |
3rd row | [153] |
4th row | [105] |
5th row | [57] |
Common Values
Value | Count | Frequency (%) |
[0] | 253 | 1.3% |
[75] | 141 | 0.7% |
[35] | 136 | 0.7% |
[25] | 132 | 0.7% |
[36] | 130 | 0.7% |
[27] | 128 | 0.6% |
[47] | 128 | 0.6% |
[76] | 127 | 0.6% |
[80] | 127 | 0.6% |
[50] | 126 | 0.6% |
Other values (538) | 18572 |
Length
Value | Count | Frequency (%) |
0 | 253 | 1.3% |
75 | 141 | 0.7% |
35 | 136 | 0.7% |
25 | 132 | 0.7% |
36 | 130 | 0.7% |
47 | 128 | 0.6% |
27 | 128 | 0.6% |
76 | 127 | 0.6% |
80 | 127 | 0.6% |
50 | 126 | 0.6% |
Other values (538) | 18572 |
Most occurring characters
Value | Count | Frequency (%) |
[ | 20000 | |
] | 20000 | |
1 | 10644 | |
2 | 6345 | 7.2% |
3 | 4887 | 5.5% |
4 | 4249 | 4.8% |
5 | 4166 | 4.7% |
6 | 3863 | 4.4% |
7 | 3828 | 4.3% |
0 | 3588 | 4.1% |
Other values (2) | 6929 | 7.8% |
Most occurring categories
Value | Count | Frequency (%) |
Decimal Number | 48499 | |
Open Punctuation | 20000 | |
Close Punctuation | 20000 |
Most frequent character per category
Decimal Number
Value | Count | Frequency (%) |
1 | 10644 | |
2 | 6345 | |
3 | 4887 | |
4 | 4249 | 8.8% |
5 | 4166 | 8.6% |
6 | 3863 | 8.0% |
7 | 3828 | 7.9% |
0 | 3588 | 7.4% |
9 | 3476 | 7.2% |
8 | 3453 | 7.1% |
Open Punctuation
Value | Count | Frequency (%) |
[ | 20000 |
Close Punctuation
Value | Count | Frequency (%) |
] | 20000 |
Most occurring scripts
Value | Count | Frequency (%) |
Common | 88499 |
Most frequent character per script
Common
Value | Count | Frequency (%) |
[ | 20000 | |
] | 20000 | |
1 | 10644 | |
2 | 6345 | 7.2% |
3 | 4887 | 5.5% |
4 | 4249 | 4.8% |
5 | 4166 | 4.7% |
6 | 3863 | 4.4% |
7 | 3828 | 4.3% |
0 | 3588 | 4.1% |
Other values (2) | 6929 | 7.8% |
Most occurring blocks
Value | Count | Frequency (%) |
ASCII | 88499 |
Most frequent character per block
ASCII
Value | Count | Frequency (%) |
[ | 20000 | |
] | 20000 | |
1 | 10644 | |
2 | 6345 | 7.2% |
3 | 4887 | 5.5% |
4 | 4249 | 4.8% |
5 | 4166 | 4.7% |
6 | 3863 | 4.4% |
7 | 3828 | 4.3% |
0 | 3588 | 4.1% |
Other values (2) | 6929 | 7.8% |
Spearman's ρ
The Spearman's rank correlation coefficient (ρ) is a measure of monotonic correlation between two variables, and is therefore better in catching nonlinear monotonic correlations than Pearson's r. It's value lies between -1 and +1, -1 indicating total negative monotonic correlation, 0 indicating no monotonic correlation and 1 indicating total positive monotonic correlation.To calculate ρ for two variables X and Y, one divides the covariance of the rank variables of X and Y by the product of their standard deviations.
Pearson's r
The Pearson's correlation coefficient (r) is a measure of linear correlation between two variables. It's value lies between -1 and +1, -1 indicating total negative linear correlation, 0 indicating no linear correlation and 1 indicating total positive linear correlation. Furthermore, r is invariant under separate changes in location and scale of the two variables, implying that for a linear function the angle to the x-axis does not affect r.To calculate r for two variables X and Y, one divides the covariance of X and Y by the product of their standard deviations.
Kendall's τ
Similarly to Spearman's rank correlation coefficient, the Kendall rank correlation coefficient (τ) measures ordinal association between two variables. It's value lies between -1 and +1, -1 indicating total negative correlation, 0 indicating no correlation and 1 indicating total positive correlation.To calculate τ for two variables X and Y, one determines the number of concordant and discordant pairs of observations. τ is given by the number of concordant pairs minus the discordant pairs divided by the total number of pairs.
Cramér's V (φc)
Cramér's V is an association measure for nominal random variables. The coefficient ranges from 0 to 1, with 0 indicating independence and 1 indicating perfect association. The empirical estimators used for Cramér's V have been proved to be biased, even for large samples. We use a bias-corrected measure that has been proposed by Bergsma in 2013 that can be found here.Phik (φk)
Phik (φk) is a new and practical correlation coefficient that works consistently between categorical, ordinal and interval variables, captures non-linear dependency and reverts to the Pearson correlation coefficient in case of a bivariate normal input distribution. There is extensive documentation available here.First rows
Unnamed: 0 | name | log2fc | chr | start | end | ensg | symbol | sequence | strand | pubmed | cas | screentype | cellline | score | hit | condition | genetargets | scoredist | effect | rc_initial | rc_final | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0 | 0 | sgA1CF_1 | 0.315907 | 10 | 50844073 | 50844096 | ENSG00000148584 | A1CF | GCAGCATCCCAACCAGGTGGAGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 2 | [260] | [244] |
1 | 1 | sgA1CF_10 | 2.144141 | 10 | 50814011 | 50814034 | ENSG00000148584 | A1CF | GCGGGAGTGAGAGGACTGGGCGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 9 | [17] | [59] |
2 | 2 | sgA1CF_2 | 1.426034 | 10 | 50836111 | 50836134 | ENSG00000148584 | A1CF | ATGACTCTCATACTCCACGAAGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 8 | [75] | [153] |
3 | 3 | sgA1CF_3 | 1.550133 | 10 | 50836095 | 50836118 | ENSG00000148584 | A1CF | GAGTCATCGAGCAGCTGCCATGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 8 | [47] | [105] |
4 | 4 | sgA1CF_4 | 0.382513 | 10 | 50816234 | 50816257 | ENSG00000148584 | A1CF | AGTCACCCTAGCAAAACCAGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [58] | [57] |
5 | 5 | sgA1CF_5 | 0.993477 | 10 | 50816119 | 50816142 | ENSG00000148584 | A1CF | GATCCCACCACAACCTACCTTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 6 | [358] | [538] |
6 | 6 | sgA1CF_6 | 0.407175 | 10 | 50815998 | 50816021 | ENSG00000148584 | A1CF | GGTGTTACCTCTAACAGAAGGGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [0] | [0] |
7 | 7 | sgA1CF_7 | 2.992138 | 10 | 50810020 | 50810043 | ENSG00000148584 | A1CF | GCTTTGGAGGTGTGAAAGGGTGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 9 | [1] | [11] |
8 | 8 | sgA1CF_8 | 0.431221 | 10 | 50813861 | 50813884 | ENSG00000148584 | A1CF | GGAGCGAGTTTAATTCCTTGGGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [118] | [120] |
9 | 9 | sgA1CF_9 | -1.101838 | 10 | 50816142 | 50816165 | ENSG00000148584 | A1CF | ATAAACTTGGCCCAAAGAGTAGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.386247 | False | viability | A1CF::ENSG00000148584 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -6 | [36] | [12] |
Last rows
Unnamed: 0 | name | log2fc | chr | start | end | ensg | symbol | sequence | strand | pubmed | cas | screentype | cellline | score | hit | condition | genetargets | scoredist | effect | rc_initial | rc_final | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
19990 | 19990 | sgC2orf70_2 | 0.656535 | 2 | 26575958 | 26575981 | ENSG00000173557 | C2orf70 | GTCCTGGAAGTACTTGAGGGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 5 | [105] | [125] |
19991 | 19991 | sgC2orf70_3 | -1.933249 | 2 | 26576039 | 26576062 | ENSG00000173557 | C2orf70 | GGGGTTGGTGGAGAAGATGGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -8 | [156] | [30] |
19992 | 19992 | sgC2orf70_4 | 1.468576 | 2 | 26577619 | 26577642 | ENSG00000173557 | C2orf70 | GGCAGGCACTCACAGGACGGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 8 | [68] | [143] |
19993 | 19993 | sgC2orf70_5 | 2.756325 | 2 | 26575919 | 26575942 | ENSG00000173557 | C2orf70 | GCCAAAGGAGAAGGCCACAGTGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 9 | [20] | [106] |
19994 | 19994 | sgC2orf70_6 | 0.915787 | 2 | 26562621 | 26562644 | ENSG00000173557 | C2orf70 | TCAGTAGGGTGCCCGCGCTGCGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 6 | [96] | [137] |
19995 | 19995 | sgC2orf70_7 | -1.496395 | 2 | 26562668 | 26562691 | ENSG00000173557 | C2orf70 | TTACCCGGGCATGAGTCCAGGGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -7 | [216] | [57] |
19996 | 19996 | sgC2orf70_8 | 0.392748 | 2 | 26576142 | 26576165 | ENSG00000173557 | C2orf70 | TCGTAAGCTCTGTGGAGCGATGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 3 | [200] | [198] |
19997 | 19997 | sgC2orf70_9 | 0.049623 | 2 | 26562610 | 26562633 | ENSG00000173557 | C2orf70 | ACCATGGCCTCCCGCAGCGCGGG | + | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.842464 | False | viability | C2orf70::ENSG00000173557 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 0 | [327] | [255] |
19998 | 19998 | sgC2orf71_1 | 0.537572 | 2 | 29073827 | 29073850 | ENSG00000179270 | C2orf71 | GTACCCAAGATACTTCCAAATGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.980295 | False | viability | C2orf71::ENSG00000179270 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | 4 | [221] | [242] |
19999 | 19999 | sgC2orf71_10 | -0.501271 | 2 | 29072182 | 29072205 | ENSG00000179270 | C2orf71 | GAAATGCAATCCCCATCCTGAGG | - | 26472758 | hSpCas9 | negative selection | Jiyoye | 0.980295 | False | viability | C2orf71::ENSG00000179270 | [[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]] | -4 | [579] | [308] |